FXYD6 (NM_001164836) Human Untagged Clone

SKU
SC327356
FXYD6 (untagged)-Human FXYD domain containing ion transport regulator 6 (FXYD6) transcript variant 4
$165.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FXYD6
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001164836, the custom clone sequence may differ by one or more nucleotides
ATGGAGTTGGTGCTGGTCTTCCTCTGCAGCCTGCTGGCCCCCATGGTCCTGGCCAGTGCA
GCTGAAAAGGAGAAGGAAATGGACCCTTTTCATTATGATTACCAGACCCTGAGGATTGGG
GGACTGGTGTTCGCTGTGGTCCTCTTCTCGGTTGGGATCCTCCTTATCCTAAGTCGCAGG
TGCAAGTGCAGTTTCAATCAGAAGCCCCGGGCCCCAGGAGATGAGGAAGCCCAGGTGGAG
AACCTCATCACCGCCAATGCAACAGAGCCCCAGAAAGCAGAGAAC
Restriction Sites Please inquire
ACCN NM_001164836
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001164836.1, NP_001158308.1
RefSeq Size 2230 bp
RefSeq ORF 288 bp
Locus ID 53826
UniProt ID Q9H0Q3
Cytogenetics 11q23.3
Protein Families Ion Channels: Other, Transmembrane
Summary This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes phosphohippolin, which likely affects the activity of Na,K-ATPase. Multiple alternatively spliced transcript variants encoding the same protein have been described. Related pseudogenes have been identified on chromosomes 10 and X. Read-through transcripts have been observed between this locus and the downstream sodium/potassium-transporting ATPase subunit gamma (FXYD2, GeneID 486) locus.[provided by RefSeq, Feb 2011]
Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:FXYD6 (NM_001164836) Human Untagged Clone
Your Rating
SKU Description Size Price
RC228721 FXYD6 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 6 (FXYD6), transcript variant 4 10 ug
$150.00
RC228721L3 Lenti-ORF clone of FXYD6 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 6 (FXYD6), transcript variant 4 10 ug
$450.00
RC228721L4 Lenti-ORF clone of FXYD6 (mGFP-tagged)-Human FXYD domain containing ion transport regulator 6 (FXYD6), transcript variant 4 10 ug
$450.00
RG228721 FXYD6 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 6 (FXYD6), transcript variant 4 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.