Class A basic helix loop helix protein 9 (BHLHA9) (NM_001164405) Human Untagged Clone

CAT#: SC326801

BHLHA9 (untagged)-Human basic helix-loop-helix family member a9 (BHLHA9)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: Class A basic helix loop helix protein 9
• Synonyms: BHLHF42; CCSPD
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_001164405 edited
  ATGCTGCGGGGCGCGCCAGGACTAGGCCTCACGGCGCGGAAGGGGGCCGAGGACTCTGCG
  GAGGACTTGGGGGGCCCCTGCCCCGAGCCCGGGGGCGATTCGGGGGTGCTGGGGGCGAAC
  GGCGCTTCCTGCAGCCGGGGCGAGGCGGAGGAGCCGGCGGGCAGGAGGCGCGCGCGGCCG
  GTGCGGTCCAAGGCGCGGCGCATGGCCGCCAACGTGCGGGAGCGCAAGCGCATCCTAGAC
  TACAACGAGGCCTTCAACGCGCTGCGCCGGGCGCTGCGGCACGACCTGGGCGGCAAGAGG
  CTCTCCAAGATCGCCACGCTGCGCAGGGCCATCCACCGCATCGCCGCGCTCTCCCTGGTC
  CTGCGCGCCAGCCCCGCGCCCCGCGGGCCCTGCGGACACCTGGAGTGCCACGGCCCGGCC
  GCGCGCGGGGACACCGGGGACACAGGCGCCAGCCCCCCGCCGCCTGCAGGGCCCAGCCTC
  GCGCGCCCAGACGCCGCCCGCCCCTCGGTGCCGTCCGCGCCCCGCTGCGCCTCGTGCCCC
  CCGCACGCGCCCCTGGCACGGCCCAGTGCGGTGGCCGAGGGGCCGGGCCTAGCACAGGCC
  TCCGGGGGAAGCTGGCGCCGCTGTCCGGGGGCTTCCTCTGCCGGGCCGCCTCCCTGGCCG
  CGGGGCTACCTGCGATCCGCCCCCGGGATGGGCCATCCGCGCTCCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_001164405
• Insert Size: 700 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001164405.1.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001164405.1, NP_001157877.1
• RefSeq Size: 708 bp
• RefSeq ORF: 708 bp
• Locus ID: 727857
• UniProt ID: Q7RTU4
• Cytogenetics: 17p13.3
• Gene Summary: This gene is a member of the basic helix-loop-helix family. The encoded protein is a transcription factor involved in limb development. Mutations in this gene have been associated with mesoaxial synostotic syndactyly Malik-Percin type (MSSD). Copy number variation of a locus containing this gene has been linked to a form of split-hand/foot malformation with long bone deficiency (SHFLD3). [provided by RefSeq, Mar 2015]