ZNF268 (NM_001165887) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | ZNF268 |
Synonyms | HZF3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001165887, the custom clone sequence may differ by one or more nucleotides
ATGGCCACCAGGGTCCGGACAGCTTCTATTTGGGGACCTTTGTCATTCATGGATGTGTTT GTGGATTTTACCTGGGAGGAGTGGCAGCTGCTAGACCCAGCACAGAAGTGCCTGTACAGG AGTGTGATGTTGGAGAACTATAGCAACCTGGTGTCCCTAGGGTACCAACACACCAAACCT GATATCATCTTCAAGTTGGAACAAGGAGAAGAGCTGTGTATGGTGCAGGCCCAAGTTCCA AATCAGACCTGTCCAATTTTGAAGGCTGGAAAGTCCAAAGCCAAGGTGCTGGCAGGTTTG GTGTCTGGTGAGGGCCTGCTCTGTGCTTCCAAGATGACGCCTTGTTGCTGCATCCTCTGG AGACACAGTCTGGAAAAT |
Restriction Sites | Please inquire |
ACCN | NM_001165887 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001165887.1, NP_001159359.1 |
RefSeq Size | 5661 bp |
RefSeq ORF | 381 bp |
Locus ID | 10795 |
UniProt ID | Q14587 |
Cytogenetics | 12q24.33 |
Protein Families | Transcription Factors |
Summary | Isoform 1: Acts as a transcriptional repressor. Inhibits erythroid differentiation and tumor cell proliferation. Plays a role during ovarian cancer development and progression.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (9) lacks an alternate in-frame exon and contains an alternate coding exon, which causes a frameshift compared to variant 1. The resulting isoform (h) lacks an internal segment and has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC228066 | ZNF268 (Myc-DDK-tagged)-Human zinc finger protein 268 (ZNF268), transcript variant 9 | 10 ug |
$165.00
|
|
RC228066L3 | Lenti-ORF clone of ZNF268 (Myc-DDK-tagged)-Human zinc finger protein 268 (ZNF268), transcript variant 9 | 10 ug |
$465.00
|
|
RC228066L4 | Lenti-ORF clone of ZNF268 (mGFP-tagged)-Human zinc finger protein 268 (ZNF268), transcript variant 9 | 10 ug |
$465.00
|
|
RG228066 | ZNF268 (tGFP-tagged) - Human zinc finger protein 268 (ZNF268), transcript variant 9 | 10 ug |
$365.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.