ETS1 (NM_001143820) Human Untagged Clone

SKU
SC325981
ETS1 (untagged)-Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ETS1
Synonyms c-ets-1; ETS-1; EWSR2; p54
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001143820 edited
ATGAGCTACTTTGTGGATTCTGCTGGGAGCAGCCCCGTCCCTTACTCAGCGCCTCGTCCT
GCAGTGGTGAGGCAAGGACCTAGCAACACTTATGAAGATCCTCGAATGAACTGTGGTTTC
CAGTCCAATTATCACCAGCAAAGACCTTGCTACCCCTTTTGGGATGAGATGGCAACTCAG
GAAGTTCCTACTGGTCTTGAACACTGTGTCTCAGATATGGAATGTGCAGATGTCCCACTA
TTAACTCCAAGCAGCAAAGAAATGATGTCTCAAGCATTAAAAGCTACTTTCAGTGGTTTC
ACTAAAGAACAGCAACGACTGGGGATCCCAAAAGACCCCCGGCAGTGGACAGAAACCCAT
GTTCGGGACTGGGTGATGTGGGCTGTGAATGAATTCAGCCTGAAAGGTGTAGACTTCCAG
AAGTTCTGTATGAATGGAGCAGCCCTCTGCGCCCTGGGTAAAGACTGCTTTCTCGAGCTG
GCCCCAGACTTTGTTGGGGACATCTTATGGGAACATCTAGAGATCCTGCAGAAAGAGGAT
GTGAAACCATATCAAGTTAATGGAGTCAACCCAGCCTATCCAGAATCCCGCTATACCTCG
GATTACTTCATTAGCTATGGTATTGAGCATGCCCAGTGTGTTCCACCATCGGAGTTCTCA
GAGCCCAGCTTCATCACAGAGTCCTATCAGACGCTCCATCCCATCAGCTCGGAAGAGCTC
CTCTCCCTCAAGTATGAGAATGACTACCCCTCGGTCATTCTCCGAGACCCTCTCCAGACA
GACACCTTGCAGAATGACTACTTTGCTATCAAACAAGAAGTCGTCACCCCAGACAACATG
TGCATGGGGAGGACCAGTCGTGGTAAACTCGGGGGCCAGGACTCTTTTGAAAGCATAGAG
AGCTACGATAGTTGTGATCGCCTCACCCAGTCCTGGAGCAGCCAGTCATCTTTCAACAGC
CTGCAGCGTGTTCCCTCCTATGACAGCTTCGACTCAGAGGACTATCCGGCTGCCCTGCCC
AACCACAAGCCCAAGGGCACCTTCAAGGACTATGTGCGGGACCGTGCTGACCTCAATAAG
GACAAGCCTGTCATTCCTGCTGCTGCCCTAGCTGGCTACACAGGCAGTGGACCAATCCAG
CTATGGCAGTTTCTTCTGGAATTACTCACTGATAAATCCTGTCAGTCTTTTATCAGCTGG
ACAGGAGATGGCTGGGAATTCAAACTTTCTGACCCAGATGAGGTGGCCAGGAGATGGGGA
AAGAGGAAAAACAAACCTAAGATGAATTATGAGAAACTGAGCCGTGGCCTACGCTACTAT
TACGACAAAAACATCATCCACAAGACAGCGGGGAAACGCTACGTGTACCGCTTTGTGTGT
GACCTGCAGAGCCTGCTGGGGTACACCCCTGAGGAGCTGCACGCCATGCTGGACGTCAAG
CCAGATGCCGACGAGTGA
Restriction Sites Please inquire
ACCN NM_001143820
Insert Size 5100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001143820.1, NP_001137292.1
RefSeq Size 5143 bp
RefSeq ORF 1458 bp
Locus ID 2113
UniProt ID P14921
Cytogenetics 11q24.3
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Dorso-ventral axis formation, Pathways in cancer, Renal cell carcinoma
Summary This gene encodes a member of the ETS family of transcription factors, which are defined by the presence of a conserved ETS DNA-binding domain that recognizes the core consensus DNA sequence GGAA/T in target genes. These proteins function either as transcriptional activators or repressors of numerous genes, and are involved in stem cell development, cell senescence and death, and tumorigenesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1).
Write Your Own Review
You're reviewing:ETS1 (NM_001143820) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227466 ETS1 (Myc-DDK-tagged)-Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1 10 ug
$686.00
RC227466L1 Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC227466L2 Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1, mGFP tagged 10 ug
$986.00
RC227466L3 Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC227466L4 Lenti ORF clone of Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1, mGFP tagged 10 ug
$986.00
RG227466 ETS1 (tGFP-tagged) - Human v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) (ETS1), transcript variant 1 10 ug
$489.00 MSRP $886.00 MSRP $886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.