UGT2B10 (NM_001144767) Human Untagged Clone

SKU
SC325935
UGT2B10 (untagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 2
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol UGT2B10
Synonyms UDPGT2B10
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001144767 edited
GGAAAAGAATTATCACATCTGCACAAGGATGGCTCTGAAATGGACTACAGTTCTGCTGAT
ACAACTCAGTTTTTACTTTAGCTCTGGGAGTTGTGGAAAGGTGCTGGTATGGGCCGCAGA
ATACAGCCTTTGGATGAATATGAAGACAATCCTGAAAGAACTTGTTCAGAGAGGTCATGA
GGTGACTGTACTGGCATCTTCAGCTTCCATTCTTTTTGATCCCAACGACTCATCCACTCT
TAAACTTGAAGTTTATCCTACATCTTTAACTAAAACTGAATTTGAGAATATCATCATGCA
ATTGGTTAAGAGATTGTCAGAAATTCAAAAAGATACATTTTGGTTACCTTTTTCACAAGA
ACAAGAAATCCTGTGGGCAATTAATGACATAATTAGAAACTTCTGTAAAGATGTAGTTTC
AAATAAGAAACTTATGAAAAAACTACAAGAGTCAAGATTTGACATCGTTTTTGCAGATGC
TTATTTACCCTGTGGAAGACCCACTACATTATCTGAGACAATGAGGAAAGCTGACATATG
GCTTATGCGAAACTCCTGGAATTTTAAATTTCCTCATCCATTCTTACCAAATGTTGATTT
TGTTGGAGGACTCCACTGCAAACCTGCCAAACCCCTACCTAAGGAAATGGAGGAGTTTGT
ACAGAGCTCTGGAGAAAATGGTGTTGTGGTGTTTTCTCTGGGGTCAATGGTCAGTAACAT
GACAGAAGAAAGGGCCAACGTAATTGCAACAGCCCTTGCCAAGATCCCACAAAAGGTTCT
TTGGAGATTTGATGGGAATAAACCAGATGCCTTAGGTCTCAATACTCGACTGTACAAGTG
GATACCCCAGAATGACCTTCTAGGTCATCCAAAAACCAGAGCTTTTATAACTCATGGTGG
AGCCAATGGCATCTATGAGGCAATCTACCATGGGATCCCTATGGTGGGCATTCCATTGTT
TTTTGATCAACCTGATAATATTGCTCACATGAAGGCCAAGGGAGCAGCTGTTAGAGTGGA
CTTCAACACAATGTCGAGTACAGACCTGCTGAATGCACTGAAGACAGTAATTAATGATCC
TTCATATAAAGAGAATATTATGAAATTATCAAGAATTCAACATGATCAACCAGTGAAGCC
CCTGGATCGAGCAGTCTTCTGGATTGAATTTGTCATGCGCCACAAAGGAGCCAAACATCT
TCGAGTTGCAGCCCACAACCTCACCTGGTTCCAGTACCACTCTTTGGATGTGATTGGGTT
CCTGCTGGCTTGTGTGGCAACCGTGCTATTTATCATCACAAAGTGTTGTCTGTTTTGTTT
CTGGAAGTTTGCTAGAAAAGGAAAGAAGGGAAAAAGGGATTAG
Restriction Sites Please inquire
ACCN NM_001144767
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001144767.1, NP_001138239.1
RefSeq Size 2504 bp
RefSeq ORF 1335 bp
Locus ID 7365
UniProt ID P36537
Cytogenetics 4q13.2
Protein Families Transmembrane
Protein Pathways Androgen and estrogen metabolism, Ascorbate and aldarate metabolism, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Pentose and glucuronate interconversions, Porphyrin and chlorophyll metabolism, Retinol metabolism, Starch and sucrose metabolism
Summary UDPGT is of major importance in the conjugation and subsequent elimination of potentially toxic xenobiotics and endogenous compounds.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:UGT2B10 (NM_001144767) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227991 UGT2B10 (Myc-DDK-tagged)-Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 2 10 ug
$457.00
RC227991L3 Lenti ORF clone of Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC227991L4 Lenti ORF clone of Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 2, mGFP tagged 10 ug
$757.00
RG227991 UGT2B10 (tGFP-tagged) - Human UDP glucuronosyltransferase 2 family, polypeptide B10 (UGT2B10), transcript variant 2 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.