CRF1 (CRHR1) (NM_001145146) Human Untagged Clone

CAT#: SC325932

CRHR1 (untagged)-Human corticotropin releasing hormone receptor 1 (CRHR1), transcript variant 1


  "NM_001145146" in other vectors (6)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-CRHR1 Antibody (N-Terminus)
    • 50 ug

USD 515.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CRF1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CRF1
Synonyms CRF-R; CRF-R-1; CRF-R1; CRF1; CRFR-1; CRFR1; CRH-R-1; CRH-R1; CRHR; CRHR1L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001145146, the custom clone sequence may differ by one or more nucleotides


ATGGGAGGGCACCCGCAGCTCCGTCTCGTCAAGGCCCTTCTCCTTCTGGGGCTGAACCCCGTCTCTGCCT
CCCTCCAGGACCAGCACTGCGAGAGCCTGTCCCTGGCCAGCAACATCTCAGGACTGCAGTGCAACGCATC
CGTGGACCTCATTGGCACCTGCTGGCCCCGCAGCCCTGCGGGGCAGCTAGTGGTTCGGCCCTGCCCTGCC
TTTTTCTATGGTGTCCGCTACAATACCACAAACAATGGCTACCGGGAGTGCCTGGCCAATGGCAGCTGGG
CCGCCCGCGTGAATTACTCCGAGTGCCAGGAGATCCTCAATGAGGAGAAAAAAAGCAAGGTGCACTACCA
TGTCGCAGTCATCATCAACTACCTGGGCCACTGTATCTCCCTGGTGGCCCTCCTGGTGGCCTTTGTCCTC
TTTCTGCGGCTCAGGCCAGGCTGCACCCATTGGGGTGACCAGGCAGATGGAGCCCTGGAGGTGGGGGCTC
CATGGAGTGGTGCCCCATTTCAGGTTCGAAGGAGCATCCGGTGCCTGCGAAACATCATCCACTGGAACCT
CATCTCCGCCTTCATCCTGCGCAACGCCACCTGGTTCGTGGTCCAGCTAACCATGAGCCCCGAGGTCCAC
CAGAGCAACGTGGGCTGGTGCAGGTTGGTGACAGCCGCCTACAACTACTTCCATGTGACCAACTTCTTCT
GGATGTTCGGCGAGGGCTGCTACCTGCACACAGCCATCGTGCTCACCTACTCCACTGACCGGCTGCGCAA
ATGGATGTTCATCTGCATTGGCTGGGGTGTGCCCTTCCCCATCATTGTGGCCTGGGCCATTGGGAAGCTG
TACTACGACAATGAGAAGTGCTGGTTTGGCAAAAGGCCTGGGGTGTACACCGACTACATCTACCAGGGCC
CCATGATCCTGGTCCTGCTGATCAATTTCATCTTCCTTTTCAACATCGTCCGCATCCTCATGACCAAGCT
CCGGGCATCCACCACGTCTGAGACCATTCAGTACAGGAAGGCTGTGAAAGCCACTCTGGTGCTGCTGCCC
CTCCTGGGCATCACCTACATGCTGTTCTTCGTCAATCCCGGGGAGGATGAGGTCTCCCGGGTCGTCTTCA
TCTACTTCAACTCCTTCCTGGAATCCTTCCAGGGCTTCTTTGTGTCTGTGTTCTACTGTTTCCTCAATAG
TGAGGTCCGTTCTGCCATCCGGAAGAGGTGGCACCGGTGGCAGGACAAGCACTCGATCCGTGCCCGAGTG
GCCCGTGCCATGTCCATCCCCACCTCCCCAACCCGTGTCAGCTTTCACAGCATCAAGCAGTCCACAGCAG
TCTGA


Restriction Sites Please inquire     
ACCN NM_001145146
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001145146.1, NP_001138618.1
RefSeq Size 2681 bp
RefSeq ORF 1335 bp
Locus ID 1394
UniProt ID P34998
Cytogenetics 17q21.31
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Long-term depression, Neuroactive ligand-receptor interaction
Gene Summary This gene encodes a G-protein coupled receptor that binds neuropeptides of the corticotropin releasing hormone family that are major regulators of the hypothalamic-pituitary-adrenal pathway. The encoded protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response and obesity. Alternative splicing results in multiple transcript variants. Naturally-occurring readthrough transcription between this gene and upstream GeneID:147081 results in transcripts that encode isoforms that share similarity with the products of this gene. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (1b, also known as CRH-R1beta), represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.