Estrogen Related Receptor gamma (ESRRG) (NM_001134285) Human Untagged Clone

SKU
SC325920
ESRRG (untagged)-Human estrogen-related receptor gamma (ESRRG), transcript variant 4
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Estrogen Related Receptor gamma
Synonyms ERR-gamma; ERR3; ERRg; ERRgamma; NR3B3
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001134285, the custom clone sequence may differ by one or more nucleotides
ATGTCAAACAAAGATCGACACATTGATTCCAGCTGTTCGTCCTTCATCAAGACGGAACCT
TCCAGCCCAGCCTCCCTGACGGACAGCGTCAACCACCACAGCCCTGGTGGCTCTTCAGAC
GCCAGTGGGAGCTACAGTTCAACCATGAATGGCCATCAGAACGGACTTGACTCGCCACCT
CTCTACCCTTCTGCTCCTATCCTGGGAGGTAGTGGGCCTGTCAGGAAACTGTATGATGAC
TGCTCCAGCACCATTGTTGAAGATCCCCAGACCAAGTGTGAATACATGCTCAACTCGATG
CCCAAGAGACTGTGTTTAGTGTGTGGTGACATCGCTTCTGGGTACCACTATGGGGTAGCA
TCATGTGAAGCCTGCAAGGCATTCTTCAAGAGGACAATTCAAGGCAATATAGAATACAGC
TGCCCTGCCACGAATGAATGTGAAATCACAAAGCGCAGACGTAAATCCTGCCAGGCTTGC
CGCTTCATGAAGTGTTTAAAAGTGGGCATGCTGAAAGAAGGGGTGCGTCTTGACAGAGTA
CGTGGAGGTCGGCAGAAGTACAAGCGCAGGATAGATGCGGAGAACAGCCCATACCTGAAC
CCTCAGCTGGTTCAGCCAGCCAAAAAGCCATATAACAAGATTGTCTCACATTTGTTGGTG
GCTGAACCGGAGAAGATCTATGCCATGCCTGACCCTACTGTCCCCGACAGTGACATCAAA
GCCCTCACTACACTGTGTGACTTGGCCGACCGAGAGTTGGTGGTTATCATTGGATGGGCG
AAGCATATTCCAGGCTTCTCCACGCTGTCCCTGGCGGACCAGATGAGCCTTCTGCAGAGT
GCTTGGATGGAAATTTTGATCCTTGGTGTCGTATACCGGTCTCTTTCGTTTGAGGATGAA
CTTGTCTATGCAGACGATTATATAATGGACGAAGACCAGTCCAAATTAGCAGGCCTTCTT
GATCTAAATAATGCTATCCTGCAGCTGGTAAAGAAATACAAGAGCATGAAGCTGGAAAAA
GAAGAATTTGTCACCCTCAAAGCTATAGCTCTTGCTAATTCAGACTCCATGCACATAGAA
GATGTTGAAGCCGTTCAGAAGCTTCAGGATGTCTTACATGAAGCGCTGCAGGATTATGAA
GCTGGCCAGCACATGGAAGACCCTCGTCGAGCTGGCAAGATGCTGATGACACTGCCACTC
CTGAGGCAGACCTCTACCAAGGCCGTGCAGCATTTCTACAACATCAAACTAGAAGGCAAA
GTCCCAATGCACAAACTTTTTTTGGAAATGTTGGAGGCCAAGGTC
Restriction Sites Please inquire
ACCN NM_001134285
Insert Size 5336 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001134285.1, NP_001127757.1
RefSeq Size 5336 bp
RefSeq ORF 1308 bp
Locus ID 2104
UniProt ID P62508
Cytogenetics 1q41
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
Summary This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) lacks the 5' exon but has three alternate 5' exons and uses a downstream AUG start codon, compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, compared to isoform 1. Variants 2-4, 9-15, and 17-21 encode the same isoform.
Write Your Own Review
You're reviewing:Estrogen Related Receptor gamma (ESRRG) (NM_001134285) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225714 ESRRG (Myc-DDK-tagged)-Human estrogen-related receptor gamma (ESRRG), transcript variant 4 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC225714L3 Lenti-ORF clone of ESRRG (Myc-DDK-tagged)-Human estrogen-related receptor gamma (ESRRG), transcript variant 4 10 ug
$757.00
RC225714L4 Lenti-ORF clone of ESRRG (mGFP-tagged)-Human estrogen-related receptor gamma (ESRRG), transcript variant 4 10 ug
$757.00
RG225714 ESRRG (tGFP-tagged) - Human estrogen-related receptor gamma (ESRRG), transcript variant 4 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.