LEF1 (NM_001130713) Human Untagged Clone

SKU
SC325836
LEF1 (untagged)-Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LEF1
Synonyms LEF-1; TCF1ALPHA; TCF7L3; TCF10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC325836 representing NM_001130713.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCCAACTCTCCGGAGGAGGTGGCGGCGGCGGGGGGGACCCGGAACTCTGCGCCACGGACGAGATG
ATCCCCTTCAAGGACGAGGGCGATCCTCAGAAGGAAAAGATCTTCGCCGAGATCAGTCATCCCGAAGAG
GAAGGCGATTTAGCTGACATCAAGTCTTCCTTGGTGAACGAGTCTGAAATCATCCCGGCCAGCAACGGA
CACGAGGTGGCCAGACAAGCACAAACCTCTCAGGAGCCCTACCACGACAAGGCCAGAGAACACCCCGAT
GACGGAAAGCATCCAGATGGAGGCCTCTACAACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATA
ATGATGCCAAATATGAATAACGACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGAACA
TCAAATAAAGTGCCCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGT
GACGAGCACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATG
TCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATC
ACCCCACCTCTTGGCTGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACTGGCATC
CCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGACAGTGACCTAATGCAC
GTGAAGCCTCAGCATGAACAGAGAAAGGAGCAGGAGCCAAAAAGACCTCACATTAAGAAGCCTCTGAAT
GCTTTTATGTTATACATGAAAGAAATGAGAGCGAATGTCGTTGCTGAGTGTACTCTAAAAGAAAGTGCA
GCTATCAACCAGATTCTTGGCAGAAGGTGGCATGCCCTCTCCCGTGAAGAGCAGGCTAAATATTATGAA
TTAGCACGGAAAGAAAGACAGCTACATATGCAGCTTTATCCAGGCTGGTCTGCAAGAGACAATTATGGT
AAGAAAAAGAAGAGGAAGAGAGAGAAACTACAGGAATCTGCATCAGGTACAGGTCCAAGAATGACAGCT
GCCTACATCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001130713
Insert Size 1116 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001130713.2
RefSeq Size 3536 bp
RefSeq ORF 1116 bp
Locus ID 51176
UniProt ID Q9UJU2
Cytogenetics 4q25
Protein Families Adult stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways Acute myeloid leukemia, Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Melanogenesis, Pathways in cancer, Prostate cancer, Thyroid cancer, Wnt signaling pathway
MW 41.2 kDa
Summary This gene encodes a transcription factor belonging to a family of proteins that share homology with the high mobility group protein-1. The protein encoded by this gene can bind to a functionally important site in the T-cell receptor-alpha enhancer, thereby conferring maximal enhancer activity. This transcription factor is involved in the Wnt signaling pathway, and it may function in hair cell differentiation and follicle morphogenesis. Mutations in this gene have been found in somatic sebaceous tumors. This gene has also been linked to other cancers, including androgen-independent prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1.
Write Your Own Review
You're reviewing:LEF1 (NM_001130713) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225565 LEF1 (Myc-DDK-tagged)-Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2 10 ug
$686.00
RC225565L3 Lenti ORF clone of Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2, Myc-DDK-tagged 10 ug
$986.00
RC225565L4 Lenti ORF clone of Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2, mGFP tagged 10 ug
$986.00
RG225565 LEF1 (tGFP-tagged) - Human lymphoid enhancer-binding factor 1 (LEF1), transcript variant 2 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.