CCRL2 (NM_001130910) Human Untagged Clone

SKU
SC325815
CCRL2 (untagged)-Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol CCRL2
Synonyms ACKR5; CKRX; CRAM; CRAM-A; CRAM-B; HCR
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001130910 edited
GCCACCATGATCTACACCCGTTTCTTAAAAGGCAGTCTGAAGATGGCCAATTACACGCTG
GCACCAGAGGATGAATATGATGTCCTCATAGAAGGTGAACTGGAGAGCGATGAGGCAGAG
CAATGTGACAAGTATGACGCCCAGGCACTCTCAGCCCAGCTGGTGCCATCACTCTGCTCT
GCTGTGTTTGTGATCGGTGTCCTGGACAATCTCCTGGTTGTGCTTATCCTGGTAAAATAT
AAAGGACTCAAACGCGTGGAAAATATCTATCTTCTAAACTTGGCAGTTTCTAACTTGTGT
TTCTTGCTTACCCTGCCCTTCTGGGCTCATGCTGGGGGCGATCCCATGTGTAAAATTCTC
ATTGGACTGTACTTCGTGGGCCTGTACAGTGAGACATTTTTCAATTGCCTTCTGACTGTG
CAAAGGTACCTAGTGTTTTTGCACAAGGGAAACTTTTTCTCAGCCAGGAGGAGGGTGCCC
TGTGGCATCATTACAAGTGTCCTGGCATGGGTAACAGCCATTCTGGCCACTTTGCCTGAA
TTCGTGGTTTATAAACCTCAGATGGAAGACCAGAAATACAAGTGTGCATTTAGCAGAACT
CCCTTCCTGCCAGCTGATGAGACATTCTGGAAGCATTTTCTGACTTTAAAAATGAACATT
TCGGTTCTTGTCCTCCCCCTATTTATTTTTACATTTCTCTATGTGCAAATGAGAAAAACA
CTAAGGTTCAGGGAGCAGAGGTATAGCCTTTTCAAGCTTGTTTTTGCCATAATGGTAGTC
TTCCTTCTGATGTGGGCGCCCTACAATATTGCATTTTTCCTGTCCACTTTCAAAGAACAC
TTCTCCCTGAGTGACTGCAAGAGCAGCTACAATCTGGACAAAAGTGTTCACATCACTAAA
CTCATCGCCACCACCCACTGCTGCATCAACCCTCTCCTGTATGCGTTTCTTGATGGGACA
TTTAGCAAATACCTCTGCCGCTGTTTCCATCTGCGTAGTAACACCCCACTTCAACCCAGG
GGGCAGTCTGCACAAGGCACATCGAGGGAAGAACCTGACCATTCCACCGAAGTGTAA
Restriction Sites Please inquire
ACCN NM_001130910
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001130910.1, NP_001124382.1
RefSeq Size 1612 bp
RefSeq ORF 1071 bp
Locus ID 9034
UniProt ID O00421
Cytogenetics 3p21.31
Protein Families Druggable Genome, GPCR, Transmembrane
Summary This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region, compared to variant 1, resulting in a longer isoform (2) that has a distinct N-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:CCRL2 (NM_001130910) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225528 CCRL2 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2 10 ug
$457.00
RC225528L1 Lenti ORF clone of Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC225528L2 Lenti ORF clone of Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2, mGFP tagged 10 ug
$757.00
RC225528L3 Lenti ORF clone of Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2, Myc-DDK-tagged 10 ug
$757.00
RC225528L4 Lenti ORF clone of Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2, mGFP tagged 10 ug
$757.00
RG225528 CCRL2 (tGFP-tagged) - Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.