DC SIGN (CD209) (NM_001144899) Human Untagged Clone

SKU
SC325654
CD209 (untagged)-Human CD209 molecule (CD209), transcript variant 8
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol DC SIGN
Synonyms CDSIGN; CLEC4L; DC-SIGN; DC-SIGN1; hDC-SIGN
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001144899, the custom clone sequence may differ by one or more nucleotides
ATGAGTGACTCCAAGGAACCAAGACTGCAGCAGCTGGGCCTCCTGGAGGAGGAACAGCTG
AGAGGCCTTGGATTCCGACAGACTCGAGGATACAAGAGCTTAGCAGGGTGTCTTGGCCAT
GGTCCCCTGGTGCTGCAACTCCTCTCCTTCACGCTCTTGGCTGGGCTCCTTGTCCAAGTG
TCCAAGGTCCCCAGCTCCATAAGTCAGGAACAATCCAGGCAAGACGCGATCTACCAGAAC
CTGACCCAGCTTAAAGCTGCAGTGGAACGCCTGTGCCACCCCTGTCCCTGGGAATGGACA
TTCTTCCAAGGAAACTGTTACTTCATGTCTAACTCCCAGCGGAACTGGCACGACTCCATC
ACCGCCTGCAAAGAAGTGGGGGCCCAGCTCGTCGTAATCAAAAGTGCTGAGGAGCAGAAC
TTCCTACAGCTGCAGTCTTCCAGAAGTAACCGCTTCACCTGGATGGGACTTTCAGATCTA
AATCAGGAAGGCACGTGGCAATGGGTGGACGGCTCACCTCTGTTGCCCAGCTTCAAGCAG
TATTGGAACAGAGGAGAGCCCAACAACGTTGGGGAGGAAGACTGCGCGGAATTTAGTGGC
AATGGCTGGAACGACGACAAATGTAATCTTGCCAAATTCTGGATCTGCAAAAAGTCCGCA
GCCTCCTGCTCCAGGGATGAAGAACAGTTTCTTTCTCCAGCCCCTGCCACCCCAAACCCC
CCTCCTGCG
Restriction Sites Please inquire
ACCN NM_001144899
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001144899.1, NP_001138371.1
RefSeq Size 3845 bp
RefSeq ORF 732 bp
Locus ID 30835
Cytogenetics 19p13.2
Protein Families Druggable Genome
Summary This gene encodes a C-type lectin that functions in cell adhesion and pathogen recognition. This receptor recognizes a wide range of evolutionarily divergent pathogens with a large impact on public health, including leprosy and tuberculosis mycobacteria, the Ebola, hepatitis C, HIV-1 and Dengue viruses, and the SARS-CoV acute respiratory syndrome coronavirus. The protein is organized into four distinct domains: a C-terminal carbohydrate recognition domain, a flexible tandem-repeat neck domain, a transmembrane region and an N-terminal cytoplasmic domain involved in internalization. This gene is closely related in terms of both sequence and function to a neighboring gene, CLEC4M (Gene ID: 10332), also known as L-SIGN. The two genes differ in viral recognition and expression patterns, with this gene showing high expression on the surface of dendritic cells. Polymorphisms in the neck region are associated with protection from HIV-1 infection, while single nucleotide polymorphisms in the promoter of this gene are associated with differing resistance and susceptibility to and severity of infectious disease, including rs4804803, which is associated with SARS severity. [provided by RefSeq, May 2020]
Transcript Variant: This variant (8) uses an alternate in-frame splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform 8) compared to isoform 1. The encoded isoform (8) has 1.5 repeats in the neck domain.
Write Your Own Review
You're reviewing:DC SIGN (CD209) (NM_001144899) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227078 CD209 (Myc-DDK-tagged)-Human CD209 molecule (CD209), transcript variant 8 10 ug
$330.00
RC227078L3 Lenti-ORF clone of CD209 (Myc-DDK-tagged)-Human CD209 molecule (CD209), transcript variant 8 10 ug
$630.00
RC227078L4 Lenti-ORF clone of CD209 (mGFP-tagged)-Human CD209 molecule (CD209), transcript variant 8 10 ug
$630.00
RG227078 CD209 (tGFP-tagged) - Human CD209 molecule (CD209), transcript variant 8 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.