SYBL1 (VAMP7) (NM_001145149) Human Untagged Clone

SKU
SC325567
VAMP7 (untagged)-Human vesicle-associated membrane protein 7 (VAMP7), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SYBL1
Synonyms SYBL1; TI-VAMP; TIVAMP; VAMP-7
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001145149, the custom clone sequence may differ by one or more nucleotides
ATGGCGATTCTTTTTGCTGTTGTTGCCAGGGGGACCACTATCCTTGCCAAACATGCTTGG
TGTGGAGGAAACTTCCTGGAGGATTTTGAACGTTCCCGAGCCTTTAATTTTCTGAATGAG
ATAAAGAAGAGGTTCCAGACTACTTACGGTTCAAGAGCACAGACAGCACTTCCATATGCC
ATGAATAGCGAGTTCTCAAGTGTCTTAGCTGCACAGCTGAAGCATCACTCTGAGAATAAG
GGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTC
AGAAACATAGATCTGGTAGCTCAGCGAGGAGAAAGATTGGAATTATTGATTGACAAAACA
GAAAATCTTGTGGATTCTTCTGTCACCTTCAAAACTACCAGCAGAAATCTTGCTCGAGCC
ATGTGTATGAAGAACCTCAAGCTCACTATTATCATCATCATCGTATCAATTGTGTTCATC
TATATCATTGTTTCACCTCTCTGTGGTGGATTTACATGGCCAAGCTGTGTGAAGAAA
Restriction Sites Please inquire
ACCN NM_001145149
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001145149.1, NP_001138621.1
RefSeq Size 2537 bp
RefSeq ORF 540 bp
Locus ID 6845
UniProt ID P51809
Cytogenetics Xq28 and Yq12
Protein Families Transcription Factors, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
Summary This gene encodes a transmembrane protein that is a member of the soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) family. The encoded protein localizes to late endosomes and lysosomes and is involved in the fusion of transport vesicles to their target membranes. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
Transcript Variant: This variant (2) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:SYBL1 (VAMP7) (NM_001145149) Human Untagged Clone
Your Rating
SKU Description Size Price
RC227306 VAMP7 (Myc-DDK-tagged)-Human vesicle-associated membrane protein 7 (VAMP7), transcript variant 2 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC227306L3 Lenti-ORF clone of VAMP7 (Myc-DDK-tagged)-Human vesicle-associated membrane protein 7 (VAMP7), transcript variant 2 10 ug
$600.00
RC227306L4 Lenti-ORF clone of VAMP7 (mGFP-tagged)-Human vesicle-associated membrane protein 7 (VAMP7), transcript variant 2 10 ug
$600.00
RG227306 VAMP7 (tGFP-tagged) - Human vesicle-associated membrane protein 7 (VAMP7), transcript variant 2 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.