GAD65 (GAD2) (NM_001134366) Human Untagged Clone

SKU
SC325214
GAD2 (untagged)-Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2
$818.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GAD65
Synonyms GAD65
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001134366, the custom clone sequence may differ by one or more nucleotides


ATGGCATCTCCGGGCTCTGGCTTTTGGTCTTTCGGGTCGGAAGATGGCTCTGGGGATTCCGAGAATCCCG
GCACAGCGCGAGCCTGGTGCCAAGTGGCTCAGAAGTTCACGGGCGGCATCGGAAACAAACTGTGCGCCCT
GCTCTACGGAGACGCCGAGAAGCCGGCGGAGAGCGGCGGGAGCCAACCCCCGCGGGCCGCCGCCCGGAAG
GCCGCCTGCGCCTGCGACCAGAAGCCCTGCAGCTGCTCCAAAGTGGATGTCAACTACGCGTTTCTCCATG
CAACAGACCTGCTGCCGGCGTGTGATGGAGAAAGGCCCACTTTGGCGTTTCTGCAAGATGTTATGAACAT
TTTACTTCAGTATGTGGTGAAAAGTTTCGATAGATCAACCAAAGTGATTGATTTCCATTATCCTAATGAG
CTTCTCCAAGAATATAATTGGGAATTGGCAGACCAACCACAAAATTTGGAGGAAATTTTGATGCATTGCC
AAACAACTCTAAAATATGCAATTAAAACAGGGCATCCTAGATACTTCAATCAACTTTCTACTGGTTTGGA
TATGGTTGGATTAGCAGCAGACTGGCTGACATCAACAGCAAATACTAACATGTTCACCTATGAAATTGCT
CCAGTATTTGTGCTTTTGGAATATGTCACACTAAAGAAAATGAGAGAAATCATTGGCTGGCCAGGGGGCT
CTGGCGATGGGATATTTTCTCCCGGTGGCGCCATATCTAACATGTATGCCATGATGATCGCACGCTTTAA
GATGTTCCCAGAAGTCAAGGAGAAAGGAATGGCTGCTCTTCCCAGGCTCATTGCCTTCACGTCTGAACAT
AGTCATTTTTCTCTCAAGAAGGGAGCTGCAGCCTTAGGGATTGGAACAGACAGCGTGATTCTGATTAAAT
GTGATGAGAGAGGGAAAATGATTCCATCTGATCTTGAAAGAAGGATTCTTGAAGCCAAACAGAAAGGGTT
TGTTCCTTTCCTCGTGAGTGCCACAGCTGGAACCACCGTGTACGGAGCATTTGACCCCCTCTTAGCTGTC
GCTGACATTTGCAAAAAGTATAAGATCTGGATGCATGTGGATGCAGCTTGGGGTGGGGGATTACTGATGT
CCCGAAAACACAAGTGGAAACTGAGTGGCGTGGAGAGGGCCAACTCTGTGACGTGGAATCCACACAAGAT
GATGGGAGTCCCTTTGCAGTGCTCTGCTCTCCTGGTTAGAGAAGAGGGATTGATGCAGAATTGCAACCAA
ATGCATGCCTCCTACCTCTTTCAGCAAGATAAACATTATGACCTGTCCTATGACACTGGAGACAAGGCCT
TACAGTGCGGACGCCACGTTGATGTTTTTAAACTATGGCTGATGTGGAGGGCAAAGGGGACTACCGGGTT
TGAAGCGCATGTTGATAAATGTTTGGAGTTGGCAGAGTATTTATACAACATCATAAAAAACCGAGAAGGA
TATGAGATGGTGTTTGATGGGAAGCCTCAGCACACAAATGTCTGCTTCTGGTACATTCCTCCAAGCTTGC
GTACTCTGGAAGACAATGAAGAGAGAATGAGTCGCCTCTCGAAGGTGGCTCCAGTGATTAAAGCCAGAAT
GATGGAGTATGGAACCACAATGGTCAGCTACCAACCCTTGGGAGACAAGGTCAATTTCTTCCGCATGGTC
ATCTCAAACCCAGCGGCAACTCACCAAGACATTGACTTCCTGATTGAAGAAATAGAACGCCTTGGACAAG
ATTTATAA


Restriction Sites Please inquire
ACCN NM_001134366
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001134366.1, NP_001127838.1
RefSeq Size 2419 bp
RefSeq ORF 1758 bp
Locus ID 2572
UniProt ID Q05329
Cytogenetics 10p12.1
Protein Families Druggable Genome
Protein Pathways Alanine, aspartate and glutamate metabolism, beta-Alanine metabolism, Butanoate metabolism, Metabolic pathways, Taurine and hypotaurine metabolism, Type I diabetes mellitus
Summary This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]
Transcript Variant: This variant (2) differs in the 3' UTR, compared to variant 1.
Write Your Own Review
You're reviewing:GAD65 (GAD2) (NM_001134366) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225984 GAD2 (Myc-DDK-tagged)-Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2 10 ug
$817.00
RC225984L1 Lenti ORF clone of Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, Myc-DDK-tagged 10 ug
$1,117.00
RC225984L2 Lenti ORF clone of Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, mGFP tagged 10 ug
$1,117.00
RC225984L3 Lenti ORF clone of Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, Myc-DDK-tagged 10 ug
$1,117.00
RC225984L4 Lenti ORF clone of Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2, mGFP tagged 10 ug
$1,117.00
RG225984 GAD2 (tGFP-tagged) - Human glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) (GAD2), transcript variant 2 10 ug
$1,017.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.