TGF beta Receptor I (TGFBR1) (NM_001130916) Human Untagged Clone
SKU
SC325085
TGFBR1 (untagged)-Human transforming growth factor, beta receptor 1 (TGFBR1), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | TGF beta Receptor I |
Synonyms | AAT5; ACVRLK4; ALK-5; ALK5; ESS1; LDS1; LDS1A; LDS2A; MSSE; SKR4; tbetaR-I; TBR-i; TBRI; TGFR-1 |
Vector | pCMV6 series |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001130916, the custom clone sequence may differ by one or more nucleotides
ATGGAGGCGGCGGTCGCTGCTCCGCGTCCCCGGCTGCTCCTCCTCGTGCTGGCGGCGGCG GCGGCGGCGGCGGCGGCGCTGCTCCCGGGGGCGACGGCGTTACAGTGTTTCTGCCACCTC TGTACAAAAGACAATTTTACTTGTGTGACAGATGGGCTCTGCTTTGTCTCTGTCACAGAG ACCACAGACAAAGTTATACACAACAGCATGTGTATAGCTGAAATTGACTTAATTCCTCGA GATAGGCCGTTTGTATGTGCACCCTCTTCAAAAACTGGGTCTGTGACTACAACATATTGC TGCAATCAGGACCATTGCAATAAAATAGAACTTCCAACTACTGGTTTACCATTGCTTGTT CAGAGAACAATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGA GAAGTTTGGAGAGGAAAGTGGCGGGGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGA GAAGAACGTTCGTGGTTCCGTGAGGCAGAGATTTATCAAACTGTAATGTTACGTCATGAA AACATCCTGGGATTTATAGCAGCAGACAATAAAGACAATGGTACTTGGACTCAGCTCTGG TTGGTGTCAGATTATCATGAGCATGGATCCCTTTTTGATTACTTAAACAGATACACAGTT ACTGTGGAAGGAATGATAAAACTTGCTCTGTCCACGGCGAGCGGTCTTGCCCATCTTCAC ATGGAGATTGTTGGTACCCAAGGAAAGCCAGCCATTGCTCATAGAGATTTGAAATCAAAG AATATCTTGGTAAAGAAGAATGGAACTTGCTGTATTGCAGACTTAGGACTGGCAGTAAGA CATGATTCAGCCACAGATACCATTGATATTGCTCCAAACCACAGAGTGGGAACAAAAAGG TACATGGCCCCTGAAGTTCTCGATGATTCCATAAATATGAAACATTTTGAATCCTTCAAA CGTGCTGACATCTATGCAATGGGCTTAGTATTCTGGGAAATTGCTCGACGATGTTCCATT GGTGGAATTCATGAAGATTACCAACTGCCTTATTATGATCTTGTACCTTCTGACCCATCA GTTGAAGAAATGAGAAAAGTTGTTTGTGAACAGAAGTTAAGGCCAAATATCCCAAACAGA TGGCAGAGCTGTGAAGCCTTGAGAGTAATGGCTAAAATTATGAGAGAATGTTGGTATGCC AATGGAGCAGCTAGGCTTACAGCATTGCGGATTAAGAAAACATTATCGCAACTCAGTCAA CAGGAAGGCATCAAAATG |
Restriction Sites | Please inquire |
ACCN | NM_001130916 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001130916.1, NP_001124388.1 |
RefSeq Size | 6244 bp |
RefSeq ORF | 1281 bp |
Locus ID | 7046 |
UniProt ID | P36897 |
Cytogenetics | 9q22.33 |
Protein Families | Druggable Genome, Protein Kinase, Transmembrane |
Protein Pathways | Adherens junction, Chronic myeloid leukemia, Colorectal cancer, Cytokine-cytokine receptor interaction, Endocytosis, MAPK signaling pathway, Pancreatic cancer, Pathways in cancer, TGF-beta signaling pathway |
Summary | The protein encoded by this gene forms a heteromeric complex with type II TGF-beta receptors when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm. The encoded protein is a serine/threonine protein kinase. Mutations in this gene have been associated with Loeys-Dietz aortic aneurysm syndrome (LDAS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (2) lacks an in-frame exon in the 5' coding region, compared to variant 3. The encoded isoform (2) is shorter than isoform 3. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC225697 | TGFBR1 (Myc-DDK-tagged)-Human transforming growth factor, beta receptor 1 (TGFBR1), transcript variant 2 | 10 ug |
$503.00
|
|
RC225697L1 | Lenti-ORF clone of TGFBR1 (Myc-DDK-tagged)-Human transforming growth factor, beta receptor 1 (TGFBR1), transcript variant 2 | 10 ug |
$803.00
|
|
RC225697L2 | Lenti-ORF clone of TGFBR1 (mGFP-tagged)-Human transforming growth factor, beta receptor 1 (TGFBR1), transcript variant 2 | 10 ug |
$803.00
|
|
RC225697L3 | Lenti-ORF clone of TGFBR1 (Myc-DDK-tagged)-Human transforming growth factor, beta receptor 1 (TGFBR1), transcript variant 2 | 10 ug |
$803.00
|
|
RC225697L4 | Lenti-ORF clone of TGFBR1 (mGFP-tagged)-Human transforming growth factor, beta receptor 1 (TGFBR1), transcript variant 2 | 10 ug |
$803.00
|
|
RG225697 | TGFBR1 (tGFP-tagged) - Human transforming growth factor, beta receptor 1 (TGFBR1), transcript variant 2 | 10 ug |
$703.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.