Growth Arrest Specific Protein 7 (GAS7) (NM_001130831) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Growth Arrest Specific Protein 7 |
Vector | pCMV6 series |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001130831, the custom clone sequence may differ by one or more nucleotides
ATGGTCCCCCCTCCGCCGGGAGAAGAAAGCCAGACGGTCATCCTTCCACCTGGCTGGCAG AGCTACCTGTCGCCTCAGGGCCGGCGGTACTATGTCAACACGACCACCAATGAGACCACC TGGGAACGTCCCAGCAGTTCTCCTGGGATTCCAGCCAGCCCTGGCTCTCACAGGAGCTCT CTGCCTCCAACAGTGAATGGATACCACGCATCAGGGACCCCAGCGCACCCTCCAGAGACT GCCCACATGAGTGTCCGAAAATCCACCGGTGATTCCCAGAACCTGGGATCCTCATCGCCA AGCAAAAAGCAGAGCAAGGAAAACACCATCACAATAAACTGTGTGACGTTCCCTCACCCA GACACGATGCCGGAACAGCAGCTGCTGAAACCAACCGAGTGGAGCTACTGCGACTACTTC TGGGCTGATAAGAAGGACCCCCAAGGCAACGGCACCGTGGCTGGGTTTGAACTACTGCTC CAGAAACAGCTGAAGGGCAAACAAATGCAGAAGGAAATGTCAGAATTCATCCGGGAAAGG ATAAAGATTGAAGAAGACTATGCGAAGAACTTAGCTAAGCTCTCTCAGAACTCCTTGGCT TCACAGGAGGAAGGCTCCTTGGGAGAGGCGTGGGCCCAGGTGAAGAAGAGCCTGGCGGAC GAAGCAGAAGTTCACCTCAAGTTCTCTGCCAAGCTTCACAGCGAGGTGGAGAAGCCCCTG ATGAACTTCCGTGAGAACTTCAAGAAAGACATGAAGAAGTGCGACCACCACATTGCCGAC CTTCGCAAGCAGCTCGCCAGCCGCTATGCCTCGGTGGAGAAGGCCCGGAAAGCCCTCACA GAGCGGCAGAGAGACCTGGAGATGAAGACCCAGCAGCTGGAGATCAAGCTGAGCAACAAG ACAGAGGAGGACATCAAGAAGGCGCGGAGAAAGTCCACACAGGCTGGAGACGACCTCATG CGCTGTGTGGATCTCTACAACCAGGCCCAGTCCAAATGGTTTGAAGAGATGGTGACCACC ACATTGGAGCTAGAGCGGCTGGAGGTGGAGAGGGTAGAGATGATCCGGCAGCACCTGTGC CAGTACACGCAGCTGCGGCATGAAACAGACATGTTCAACCAAAGCACAGTCGAGCCCGTG GATCAGCTGCTTCGAAAAGTGGACCCGGCCAAAGACAGGGAGCTGTGGGTCAGAGAGCAC AAGACGGGCAACATCCGCCCTGTGGACATGGAGATC |
Restriction Sites | Please inquire |
ACCN | NM_001130831 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001130831.1, NP_001124303.1 |
RefSeq Size | 8024 bp |
RefSeq ORF | 1239 bp |
Locus ID | 8522 |
UniProt ID | O60861 |
Cytogenetics | 17p13.1 |
Protein Families | Transcription Factors |
Summary | Growth arrest-specific 7 is expressed primarily in terminally differentiated brain cells and predominantly in mature cerebellar Purkinje neurons. GAS7 plays a putative role in neuronal development. Several transcript variants encoding proteins which vary in the N-terminus have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (d) uses an alternate first exon resulting in a shorter 5' UTR and alternative translation initiation site, compared to variant c. The encoded protein (isoform d) is shorter than that encoded by variant c. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC225647 | GAS7 (Myc-DDK-tagged)-Human growth arrest-specific 7 (GAS7), transcript variant d | 10 ug |
$503.00
|
|
RC225647L3 | Lenti-ORF clone of GAS7 (Myc-DDK-tagged)-Human growth arrest-specific 7 (GAS7), transcript variant d | 10 ug |
$803.00
|
|
RC225647L4 | Lenti-ORF clone of GAS7 (mGFP-tagged)-Human growth arrest-specific 7 (GAS7), transcript variant d | 10 ug |
$803.00
|
|
RG225647 | GAS7 (tGFP-tagged) - Human growth arrest-specific 7 (GAS7), transcript variant d | 10 ug |
$703.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.