DOK3 (NM_001144875) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | DOK3 |
Synonyms | DOKL |
Vector | pCMV6 series |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001144875, the custom clone sequence may differ by one or more nucleotides
ATGGACCCTCTGGAGACCCCTATCAAGGATGGCATCCTCTACCAGCAGCATGTCAAGTTT GGCAAGAAGTGCTGGCGGAAGGTGTGGGCTCTGCTGTATGCAGGAGGCCCATCAGGCGTG GCACGGCTGGAGAGCTGGGAGGTCCGGGATGGTGGCCTGGGAGCAGCGGGTGACAGGTCG GCAGGGCCTGGCCGGCGAGGGGAGCGACGGGTCATCCGCCTGGCTGACTGTGTGTCCGTG CTGCCGGCTGACGGCGAGAGCTGCCCCCGGGACACCGGTGCCTTCCTGCTCACCACCACC GAGCGAAGCCATCTACTGGCTGCTCAGCACCGCCAGGCCTGGATGGGCCCCATCTGCCAG CTGGCCTTCCCGGGGACAGGGGAGGCCTCCTCAGGATCCACAGATGCCCAGTCTCCCAAG AGGGGCCTGGTCCCCATGGAGGAAAACTCCATCTACTCCTCCTGGCAGGAAGTGGGCGAG TTTCCCGTGGTGGTGCAGAGGACTGAGGCCGCCACCCGCTGCCAGCTGAAGGGGCCGGCC CTGCTGGTGCTGGGCCCAGACGCCATCCAGCTGAGGGAGGCCAAGGGCACCCAGGCCCTC TACAGCTGGCCCTACCACTTCCTGCGCAAGTTCGGCTCCGACAAGATACTTCTGGGAACC CCAGGCGTCAGTCTCCTCATCTGTAAAGGAGAGAGAACCGATGACGTATCAGGCATAATC CTTGATGAGAGTTTGCTGCGTGCCTACTCAGTGCCAGGCGCTGGGGGACACAGCCGTGTT CAGGACAGCCTTGGTCCTGTTCTCCGGGAGCCGACATTCCAGGGGGAGAGAAGTTTCCTG AAGACTTCCATGCTGCGTTCCCTCCTCTGCTCCTGCTCCTGGCGCCATCCTAGGAGCCAG CCACGCACGCAAGCGTCATGCCTCCAGGGCTCTGACTGCCCAGCCCCTCACCGCAACTCC ACCTCAGCTGCACACACCCTTGGCACATCC |
Restriction Sites | Please inquire |
ACCN | NM_001144875 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001144875.1, NP_001138347.1 |
RefSeq Size | 2354 bp |
RefSeq ORF | 993 bp |
Locus ID | 79930 |
UniProt ID | Q7L591 |
Cytogenetics | 5q35.3 |
Protein Families | Druggable Genome |
Summary | DOK proteins are enzymatically inert adaptor or scaffolding proteins. They provide a docking platform for the assembly of multimolecular signaling complexes. DOK3 is a negative regulator of JNK signaling in B-cells through interaction with INPP5D/SHIP1. May modulate ABL1 function (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains alternate 5' exon structure and an alternate 3' terminal exon, and it thus initiates translation at a downstream in-frame start codon, and differs in both UTRs and the 3' coding region, compared to variant 1. The encoded isoform (2) is shorter at the N-terminus and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC227445 | DOK3 (Myc-DDK-tagged)-Human docking protein 3 (DOK3), transcript variant 2 | 10 ug |
$330.00
|
|
RC227445L3 | Lenti-ORF clone of DOK3 (Myc-DDK-tagged)-Human docking protein 3 (DOK3), transcript variant 2 | 10 ug |
$630.00
|
|
RC227445L4 | Lenti-ORF clone of DOK3 (mGFP-tagged)-Human docking protein 3 (DOK3), transcript variant 2 | 10 ug |
$630.00
|
|
RG227445 | DOK3 (tGFP-tagged) - Human docking protein 3 (DOK3), transcript variant 2 | 10 ug |
$530.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.