p38 (CRK) (NM_016823) Human Untagged Clone
CAT#: SC324918
CRK (untagged)-Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant II
"NM_016823" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | p38 |
Synonyms | CRKII; p38 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324918 representing NM_016823.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGGAGGTTGAGTCGGCAGGAGGCG GTGGCGCTGCTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGAC TATGTGCTCAGCGTCTCAGAGAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCGCGCCCG CCGGTGCCACCGTCGCCCGCCCAGCCTCCGCCCGGGGTGAGCCCCTCCAGACTCCGAATAGGAGATCAA GAGTTTGATTCATTGCCTGCTTTACTGGAATTCTACAAAATACACTATTTGGACACTACAACGTTGATA GAACCAGTTTCCAGATCCAGGCAGGGTAGTGGAGTGATTCTCAGGCAGGAGGAGGCGGAGTATGTGCGA GCCCTCTTTGACTTTAATGGGAATGATGAGGAAGATCTTCCCTTTAAGAAAGGAGACATCTTGAGAATC CGGGACAAGCCTGAAGAGCAGTGGTGGAATGCGGAGGACAGCGAAGGCAAGAGAGGGATGATTCCAGTC CCTTACGTCGAGAAGTATAGACCTGCCTCCGCCTCAGTATCGGCTCTGATTGGAGGTAACCAGGAGGGT TCCCACCCACAGCCACTGGGTGGGCCGGAGCCTGGGCCCTATGCCCAACCCAGCGTCAACACTCCGCTC CCTAACCTCCAGAATGGGCCCATATATGCCAGGGTTATCCAGAAGCGAGTCCCCAATGCCTACGACAAG ACAGCCTTGGCTTTGGAGGTCGGTGAGCTGGTAAAGGTTACGAAGATTAATGTGAGTGGTCAGTGGGAA GGGGAGTGTAATGGCAAACGAGGTCACTTCCCATTCACACATGTCCGTCTGCTGGATCAACAGAATCCC GATGAGGACTTCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_016823 |
Insert Size | 915 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_016823.3 |
RefSeq Size | 3225 bp |
RefSeq ORF | 915 bp |
Locus ID | 1398 |
UniProt ID | P46108 |
Cytogenetics | 17p13.3 |
Domains | SH2, SH3 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Chemokine signaling pathway, Chronic myeloid leukemia, ErbB signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Insulin signaling pathway, MAPK signaling pathway, Neurotrophin signaling pathway, Pathways in cancer, Regulation of actin cytoskeleton, Renal cell carcinoma |
MW | 33.8 kDa |
Gene Summary | This gene encodes a member of an adapter protein family that binds to several tyrosine-phosphorylated proteins. The product of this gene has several SH2 and SH3 domains (src-homology domains) and is involved in several signaling pathways, recruiting cytoplasmic proteins in the vicinity of tyrosine kinase through SH2-phosphotyrosine interaction. The N-terminal SH2 domain of this protein functions as a positive regulator of transformation whereas the C-terminal SH3 domain functions as a negative regulator of transformation. Two alternative transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (II) includes an alternate segment, compared to variant I, resulting in a longer protein (isoform a) that has a distinct C-terminus and an additional SH3 domain, compared to isoform b. Isoform a is a negative modulator of transformation activity. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201701 | CRK (Myc-DDK-tagged)-Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant II |
USD 300.00 |
|
RC201701L1 | Lenti ORF clone of Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant II, Myc-DDK-tagged |
USD 600.00 |
|
RC201701L2 | Lenti ORF clone of Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant II, mGFP tagged |
USD 600.00 |
|
RC201701L3 | Lenti ORF clone of Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant II, Myc-DDK-tagged |
USD 600.00 |
|
RC201701L4 | Lenti ORF clone of Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant II, mGFP tagged |
USD 600.00 |
|
RG201701 | CRK (tGFP-tagged) - Human v-crk sarcoma virus CT10 oncogene homolog (avian) (CRK), transcript variant II |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review