Mortality Factor 4 like 2 (MORF4L2) (NM_001142419) Human Untagged Clone

SKU
SC324884
MORF4L2 (untagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 3
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Mortality Factor 4 like 2
Synonyms MORFL2; MRGX
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001142419, the custom clone sequence may differ by one or more nucleotides
ATGAGTTCCAGAAAGCAGGGTTCTCAACCTCGTGGACAGCAATCTGCAGAAGAAGAGAAC
TTCAAAAAACCAACTAGAAGCAACATGCAGAGAAGTAAAATGAGAGGGGCCTCCTCAGGA
AAGAAGACAGCTGGTCCACAGCAGAAAAATCTTGAACCAGCTCTCCCAGGAAGATGGGGT
GGTCGCTCTGCAGAGAACCCCCCTTCAGGATCCGTGAGGAAGACCAGAAAGAACAAGCAG
AAGACTCCTGGAAACGGAGATGGTGGCAGTACCAGCGAAGCACCTCAGCCCCCTCGGAAG
AAAAGGGCCCGGGCAGACCCCACTGTTGAAAGTGAGGAGGCGTTTAAGAATAGAATGGAG
GTTAAAGTGAAGATTCCTGAAGAATTAAAACCATGGCTTGTTGAGGACTGGGACTTAGTT
ACCAGGCAGAAGCAGCTGTTTCAACTCCCTGCCAAGAAAAATGTAGATGCAATTCTGGAG
GAGTATGCAAATTGCAAGAAATCGCAGGGAAATGTTGATAATAAGGAATATGCGGTTAAT
GAAGTTGTGGCAGGAATAAAAGAATATTTCAATGTGATGTTGGGCACTCAGCTGCTCTAC
AAATTTGAGAGGCCCCAGTATGCTGAAATCCTCTTGGCTCACCCTGATGCTCCAATGTCC
CAGGTTTATGGAGCACCACACCTACTGAGATTATTTGTAAGAATTGGAGCAATGTTGGCC
TATACGCCCCTTGATGAGAAAAGCCTTGCATTATTGTTGGGCTATTTGCATGATTTCCTA
AAATATCTGGCAAAGAATTCTGCATCTCTCTTTACTGCCAGTGATTACAAAGTGGCTTCT
GCTGAGTACCACCGCAAAGCCCTG
Restriction Sites Please inquire
ACCN NM_001142419
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001142419.1, NP_001135891.1
RefSeq Size 1980 bp
RefSeq ORF 867 bp
Locus ID 9643
UniProt ID B3KP92
Cytogenetics Xq22.2
Protein Families Transcription Factors
Summary Component of the NuA4 histone acetyltransferase complex which is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histone H4 and H2A. This modification may both alter nucleosome - DNA interactions and promote interaction of the modified histones with other proteins which positively regulate transcription. This complex may be required for the activation of transcriptional programs associated with oncogene and proto-oncogene mediated growth induction, tumor suppressor mediated growth arrest and replicative senescence, apoptosis, and DNA repair. The NuA4 complex ATPase and helicase activities seem to be, at least in part, contributed by the association of RUVBL1 and RUVBL2 with EP400. NuA4 may also play a direct role in DNA repair when directly recruited to sites of DNA damage. Also component of the MSIN3A complex which acts to repress transcription by deacetylation of nucleosomal histones.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1.
Write Your Own Review
You're reviewing:Mortality Factor 4 like 2 (MORF4L2) (NM_001142419) Human Untagged Clone
Your Rating
SKU Description Size Price
RC226563 MORF4L2 (Myc-DDK-tagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 3 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RC226563L3 Lenti-ORF clone of MORF4L2 (Myc-DDK-tagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 3 10 ug
$600.00
RC226563L4 Lenti-ORF clone of MORF4L2 (mGFP-tagged)-Human mortality factor 4 like 2 (MORF4L2), transcript variant 3 10 ug
$600.00
RG226563 MORF4L2 (tGFP-tagged) - Human mortality factor 4 like 2 (MORF4L2), transcript variant 3 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.