SRP9 (NM_001130440) Human Untagged Clone

SKU
SC324701
SRP9 (untagged)-Human signal recognition particle 9kDa (SRP9), transcript variant 1
$165.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SRP9
Synonyms ALURBP
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001130440, the custom clone sequence may differ by one or more nucleotides
ATGCCGCAGTACCAGACCTGGGAGGAGTTCAGCCGCGCTGCCGAGAAGCTTTACCTCGCT
GACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAACTTGTGTGTT
AAAGTAACAGATGATTTAGTTAGACAGTGTCTTGCTCTATTGCTCAGGCTGCAGTGCAGT
GGCATGATCATAGCTCACTGCATCCTCGACCTCCTGGGCTCAAGCGGTCCTCTTGCTTCA
GCCTCC
Restriction Sites Please inquire
ACCN NM_001130440
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001130440.1, NP_001123912.1
RefSeq Size 1648 bp
RefSeq ORF 249 bp
Locus ID 6726
UniProt ID P49458
Cytogenetics 1q42.12
Protein Families Druggable Genome
Protein Pathways Protein export
Summary Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) is the longer transcript but encodes the shorter isoform (1).
Write Your Own Review
You're reviewing:SRP9 (NM_001130440) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225000 SRP9 (Myc-DDK-tagged)-Human signal recognition particle 9kDa (SRP9), transcript variant 1 10 ug
$165.00
RC225000L3 Lenti-ORF clone of SRP9 (Myc-DDK-tagged)-Human signal recognition particle 9kDa (SRP9), transcript variant 1 10 ug
$465.00
RC225000L4 Lenti-ORF clone of SRP9 (mGFP-tagged)-Human signal recognition particle 9kDa (SRP9), transcript variant 1 10 ug
$465.00
RG225000 SRP9 (tGFP-tagged) - Human signal recognition particle 9kDa (SRP9), transcript variant 1 10 ug
$365.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.