CTCF (NM_006565) Human Untagged Clone

CAT#: SC324590

CTCF (untagged)-Human CCCTC-binding factor (zinc finger protein) (CTCF), transcript variant 1


  "NM_006565" in other vectors (7)

Reconstitution Protocol

USD 667.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
CTCF Rabbit polyclonal Antibody
    • 100 ul

USD 365.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "CTCF"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CTCF
Synonyms CFAP108; FAP108; MRD21
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_006565.2 GTGGAGCGATTAAACCGTGCGCGGAGCTGCTTCTTTGGCGGCAGCGGCGGCGGCGGTGGC
CGGTGCGGACGCGCGGAGCTCGCCGGAGACGCCGGGTGGCCGGAGCCGTGGAGCGGCGGC
GGAGCGGGCGCCGCGGGGGGTGTGGCGCGGAGAATGATTACGGACCTGAAGCCAAAGAAC
AAGATGCGCTAGTGGACAGATTGCTGACCAGGGGCTTGAGAGCTGGGTTCTATTTTCCCT
CCTCAAACTGACTTTGCAGCCACGGAGAGGCAGGGGAAATGGAAGGTGATGCAGTCGAAG
CCATTGTGGAGGAGTCCGAAACTTTTATTAAAGGAAAGGAGAGAAAGACTTACCAGAGAC
GCCGGGAAGGGGGCCAGGAAGAAGATGCCTGCCACTTACCCCAGAACCAGACGGATGGGG
GTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGATGGTGATGATGGAACAGCTGGACC
CCACCCTTCTTCAGATGAAGACTGAAGTAATGGAGGGCACAGTGGCTCCAGAAGCAGAGG
CTGCTGTGGACGATACCCAGATTATAACTTTACAGGTTGTAAATATGGAGGAACAGCCCA
TAAACATAGGAGAACTTCAGCTTGTTCAAGTACCTGTTCCTGTGACTGTACCTGTTGCTA
CCACTTCAGTAGAAGAACTTCAGGGGGCTTATGAAAATGAAGTGTCTAAAGAGGGCCTTG
CGGAAAGTGAACCCATGATATGCCACACCCTACCTTTGCCTGAAGGGTTTCAGGTGGTTA
AAGTGGGGGCCAATGGAGAGGTGGAGACACTAGAACAAGGGGAACTTCCACCCCAGGAAG
ATCCTAGTTGGCAAAAAGACCCAGACTATCAGCCACCAGCCAAAAAAACAAAGAAAACCA
AAAAGAGCAAACTGCGTTATACAGAGGAGGGCAAAGATGTAGATGTGTCTGTCTACGATT
TTGAGGAAGAACAGCAGGAGGGTCTGCTATCAGAGGTTAATGCAGAGAAAGTGGTTGGTA
ATATGAAGCCTCCAAAGCCAACAAAAATTAAAAAGAAAGGTGTAAAGAAGACATTCCAGT
GTGAGCTTTGCAGTTACACGTGTCCACGGCGTTCAAATTTGGATCGTCACATGAAAAGCC
ACACTGATGAGAGACCACACAAGTGCCATCTCTGTGGCAGGGCATTCAGAACAGTCACCC
TCCTGAGGAATCACCTTAACACACACACAGGTACTCGTCCTCACAAGTGCCCAGACTGCG
ACATGGCCTTTGTGACCAGTGGAGAATTGGTTCGGCATCGTCGTTACAAACACACCCACG
AGAAGCCATTCAAGTGTTCCATGTGCGATTACGCCAGTGTAGAAGTCAGCAAATTAAAAC
GTCACATTCGCTCTCATACTGGAGAGCGTCCGTTTCAGTGCAGTTTGTGCAGTTATGCCA
GCAGGGACACATACAAGCTGAAAAGGCACATGAGAACCCATTCAGGGGAAAAGCCTTATG
AATGTTATATTTGTCATGCTCGGTTTACCCAAAGTGGTACCATGAAGATGCACATTTTAC
AGAAGCACACAGAAAATGTGGCCAAATTTCACTGTCCCCACTGTGACACAGTCATAGCCC
GAAAAAGTGATTTGGGTGTCCACTTGCGAAAGCAGCATTCCTATATTGAGCAAGGCAAGA
AATGCCGTTACTGTGATGCTGTGTTTCATGAGCGCTATGCCCTCATCCAGCATCAGAAGT
CACACAAGAATGAGAAGCGCTTTAAGTGTGACCAGTGTGATTACGCTTGTAGACAGGAGA
GGCACATGATCATGCACAAGCGCACCCACACCGGGGAGAAGCCTTACGCCTGCAGCCACT
GCGATAAGACCTTCCGCCAGAAGCAGCTTCTCGACATGCACTTCAAGCGCTATCACGACC
CCAACTTCGTCCCTGCGGCTTTTGTCTGTTCTAAGTGTGGGAAAACATTTACACGTCGGA
ATACCATGGCAAGACATGCTGATAATTGTGCTGGCCCAGATGGCGTAGAGGGGGAAAATG
GAGGAGAAACGAAGAAGAGTAAACGTGGAAGAAAAAGAAAGATGCGCTCTAAGAAAGAAG
ATTCCTCTGACAGTGAAAATGCTGAACCAGATCTGGACGACAATGAGGATGAGGAGGAGC
CTGCCGTAGAAATTGAACCTGAGCCAGAGCCTCAGCCTGTGACCCCAGCCCCACCACCCG
CCAAGAAGCGGAGAGGACGACCCCCTGGCAGAACCAACCAGCCCAAACAGAACCAGCCAA
CAGCTATCATTCAGGTTGAAGACCAGAATACAGGTGCAATTGAGAACATTATAGTTGAAG
TAAAAAAAGAGCCAGATGCTGAGCCCGCAGAGGGAGAGGAAGAGGAGGCCCAGCCAGCTG
CCACAGATGCCCCCAACGGAGACCTCACGCCCGAGATGATCCTCAGCATGATGGACCGGT
GATGGCGGAGCCTTGTGCGTCGCCAGGACTTCTCTGGGCTGTGTTTAAACGGCCCGCATC
TTAATTTTTCTCCCTTCTTTCTTTTTTTGGCTTTGGGAAAAGCATCATTTTACCAAACAT
ACCGAGAACGAAAACTTCAAGGATGATGTTAGAAAAAAATGTGATTTAACTAGAACTTGC
TGTCTGATGTTAGCAAATCATGGAATGTTCTGAGTCCCTGAGGGTTTACTGTGAAGTGCT
GAGGACAGTGTTGACAACTAACTCGTTTTCCTAGATGGAAACGGAGACATTGACCCCTCC
CTCCATGTGGTAAACCACTCCAGAATGGCCACCAGGCTTCCCAGAGTTCTATGGTCTTCT
TCCCAAGAGAGTTTTTAATTGTAAATGCATACTTGGGAAGGACTTAGAGTTTTAAACTGT
TTTTTGCTTTTGCTTTTCCCTGACTCCCTTTGCTTGGAGTCAGCTGCACACCAGTAGTAT
GGCATGCTACGATCAGGTTCTGTCCTGAAAGCTTTGCCTCTTTCTTGGCAAAGTTTCTGG
TATGGTCAAGCTTGTAAATAACTTTTTTTACATTTTAATCTTTTCCATTAATTAAGAGGT
TGAAAAGAAGTGCAGTGTAAGAAAACCCAGCATTTTAATTACTTGCAAATTAAGTTACCA
CAGACTCTGTAGTGTGTAAATGTTGACAAGGAATTGGATCACAATCATGTAGCAGAATGG
CACCCAGACCACTGCCCACCAGTGACGGACATGCACGTGGCAGATCATGATTTCCAGCCC
ACGGAGCCAGCATTTGAACCTTGTATAATTAACTTTCAGTTATGATTTCCCATCGACATT
TTCTTTGCCCTGTTTGTAGCTGATTGTTGTGTTTTATAAATCTTCTGTTAAGGCAGAAGG
GTGATTATGAGTGGTTCACAGCAGCCCTTATAAGCTGGGCCAGAAAATTTCACTAGGTCA
GTAATTTAAACCTTGGATCTTCAAAAAAAAAAAAAAAAAA
Restriction Sites SgfI-XhoI     
ACCN NM_006565
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006565.2, NP_006556.1
RefSeq Size 3797 bp
RefSeq ORF 2184 bp
Locus ID 10664
UniProt ID P49711
Cytogenetics 16q22.1
Domains zf-C2H2
Protein Families Transcription Factors
Gene Summary This gene is a member of the BORIS + CTCF gene family and encodes a transcriptional regulator protein with 11 highly conserved zinc finger (ZF) domains. This nuclear protein is able to use different combinations of the ZF domains to bind different DNA target sequences and proteins. Depending upon the context of the site, the protein can bind a histone acetyltransferase (HAT)-containing complex and function as a transcriptional activator or bind a histone deacetylase (HDAC)-containing complex and function as a transcriptional repressor. If the protein is bound to a transcriptional insulator element, it can block communication between enhancers and upstream promoters, thereby regulating imprinted expression. Mutations in this gene have been associated with invasive breast cancers, prostate cancers, and Wilms' tumors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
Transcript Variant: This variant (1) is the longer transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.