KChIP2 (KCNIP2) (NM_173192) Human Untagged Clone

CAT#: SC324582

Reviews ()
Write a review

KCNIP2 (untagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 3


  View "NM_173192" in other vectors (6)

USD 420.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name KChIP2 (KCNIP2) (NM_173192) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol KCNIP2
Synonyms KCHIP2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_173192.2 GGCTCTGCGCTCACCTGCTGCCTAGTGTTCCCTCTCCTGCTCCAGGACCTCCGGGTAGAC
CTCAGACCCCGGGCCCATTCCCAGACTCAGCCTCAGCCCGGACTTCCCCAGCCCCGACAG
CACAGTAGGCCGCCAGGGGGCGCCGTGTGAGCGCCCTATCCCGGCCACCCGGCGCCCCCT
CCCACGGCCCGGGCGGGAGCGGGGCGCCGGGGGCCATGCGGGGCCAGGGCCGCAAGGAGA
GTTTGTCCGATTCCCGAGACCTGGACGGCTCCTACGACCAGCTCACGGGCCACCCTCCAG
GGCCCACTAAAAAAGCGCTGAAGCAGCGATTCCTCAAGCTGCTGCCGTGCTGCGGGCCCC
AAGCCCTGCCCTCAGTCAGTGAAAACAGCGTGGACGATGAATTTGAATTGTCCACCGTGT
GTCACCGGCCTGAGGGTCTGGAGCAGCTGCAGGAGCAAACCAAATTCACGCGCAAGGAGT
TGCAGGTCCTGTACCGGGGCTTCAAGAACGAATGTCCCAGCGGAATTGTCAATGAGGAGA
ACTTCAAGCAGATTTACTCCCAGTTCTTTCCTCAAGGAGACTCCAGCACCTATGCCACTT
TTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCGGTCAGTTTTGAGGACTTTGTGG
CTGGTTTGTCCGTGATTCTTCGGGGAACTGTAGATGACAGGCTTAATTGGGCCTTCAACC
TGTATGACCTTAACAAGGACGGCTGCATCACCAAGGAGGAAATGCTTGACATCATGAAGT
CCATCTATGACATGATGGGCAAGTACACGTACCCTGCACTCCGGGAGGAGGCCCCAAGGG
AACACGTGGAGAGCTTCTTCCAGAAGATGGACAGAAACAAGGATGGTGTGGTGACCATTG
AGGAATTCATTGAGTCTTGTCAAAAGGATGAGAACATCATGAGGTCCATGCAGCTCTTTG
ACAATGTCATCTAGCCCCCAGGAGAGGGGGTCAGTGTTTCCTGGGGGGACCATGCTCTAA
CCCTAGTCCAGGCGGACCTCACCCTTCTCTTCCCAGGTCTATCCTCATCCTACGCCTCCC
TGGGGGCTGGAGGGATCCAAGAGCTTGGGGATTCAGTAGTCCAGATCTCTGGAGCTGAAG
GGGCCAGAGAGTGGGCAGAGTGCATCTCGGGGGGTGTTCCCAACTCCCACCAGCTCTCAC
CCCCTTCCTGCCTGACACCCAGTGTTGAGAGTGCCCCTCCTGTAGGAATTGAGCGGTTCC
CCACCTCCTACCCCTACTCTAGAAACACACTAGACAGATGTCTCCTGCTATGGTGCTTCC
CCCATCCCTGACCTCATAAACATTTCCCCTAAGACTCCCCTCTCAGAGAGAATGCTCCAT
TCTTGGCACTGGCTGGCTTCTCAGACCAGCCATTGAGAGCCCTGTGGGAGGGGGACAAGA
ATGTATAGGGAGAAATCTTGGGCCTGAGTCAATGGATAGGTCCTAGGAGGTGGCTGGGGT
TGAGAATAGAAGGGCCTGGACAGATTATGATTGCTCAGGCATACCAGGTTATAGCTCCAA
GTTCCACAGGTCTGCTACCACAGGCCATCAAAATATAAGTTTCCAGGCTTTGCAGAAGAC
CTTGTCTCCTTAGAAATGCCCCAGAAATTTTCCAAACCCTCCTCGGTATCCATGGAGAGC
CTGGGGCCAGATATCTGGCTCATCTCTGGCATTGCTTCCTCTCCTTCCTTCCTGCATGTG
TTGGTGGTGGTTGTGGTGGGGGAATGTGGATGGGGGATGTCCTGGCTGATGCCTGCCAAA
ATTTCATCCCACCCTCCTTGCTTATCGTCCCTGTTTTGAGGGCTATGACTTGAGTTTTTG
TTTCCCATGTTCTCTATAGACTTGGGACCTTCCTGAACTTGGGGCCTATCACTCCCCACA
GTGGATGCCTTAGAAGGGAGAGGGAAGGAGGGAGGCAGGCATAGCATCTGAACCCAGTGT
GGGGGCATTCACTAGAATCTTCAATCAACCTGGGCTCTCCCCACCCCACCCCAGATAACC
TCCTCAGTTCCCTAGGGTCTCTTCTTGCTTGACTCAATCTACCCAGAGATGCCCCTTAGC
ACACCTAGAGGGCAGGGACCATAGGACCCAGGTTCCAACCCCATTGTCAGCACCCCAGCC
ATGCGGCCACCCCTTAGCACACCTGCTCGTCCCATTTAGCTTACCCTCCCAGTTGGCCAG
AATCTGAGGGGAGAGCCCCCAGAGAGCCCCCTTCCCCATCAGAAGACTGTTGACTGCTTT
GCATTTTGGGCTCTTCTATATATTTTGTAAAGTAAGAAATATACCAGATCTAATAAAACA
CAATGGCTATGCAAAAAAAAAAAAAAA
>OriGene 5' read for NM_173192.2 unedited
GTACTAATTTGTATACGACTCCTATAGGGCGGCCGGCGATCGCGGCGCGCCGGTACCGGT
CCGGAATTCCCGGGATATCGTCGACCCACGCGTCCGGGCTCTGCGCTCACCTGCTGCCTA
GTGTTCCCTCTCCTGCTCCAGGACCTCCGGGTAGACCTCAGACCCCGGGCCCATTCCCAG
ACTCAGCCTCAGCCCGGACTTCCCCAGCCCCGACAGCACAGTAGGCCGCCAGGGGGCGCC
GTGTGAGCGCCCTATCCCGGCCACCCGGCGCCCCCTCCCACGGCCCGGGCGGGAGCGGGG
CGCCGGGGGCCATGCGGGGCCAGGGCCGCAAGGAGAGTTTGTCCGATTCCCGAGACCTGG
ACGGCTCCTACGACCAGCTCACGGGCCACCCTCCAGGGCCCACTAAAAAAGCGCTGAAGC
AGCGATTCCTCAAGCTGCTGCCGTGCTGCGGGCCCCAAGCCCTGCCCTCAGTCAGTGAAA
ACAGCGTGGACGATGAATTTGAATTGTCCACCGTGTGTCACCGGCCTGAGGGTCTGGAGC
AGCTGCAGGAGCAAACCAAATTCACGCGCAAGGAGTTGCAGGTCCTGTACCCGGGGCTTC
AAGATCGAATGTCCCAGCGGAATTGTCATATGAGGAGAACTTCAAGCAGATTTACTCCCA
GTTCTTTTCTTTAAGGAGACTCCAGCACCTATGCCCACTTTTTCTCTTCAATGCCTTTGA
CACCCACCATGATGGCTCCGGTCAATTTTGATGGACTTTGTGCTTGGTTTGCCGCGAATC
CCTCTGGGGAACTGTAAATGACACGGCTTACTTGGTCCTTCCACCTGGTATGAC
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_173192
ORF Size 759 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_173192.2, NP_775284.1
RefSeq Size 2509
RefSeq ORF 759
Locus ID 30819
Cytogenetics 10q24.32
Protein Families Druggable Genome, Ion Channels: Other
Gene Summary This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belongs to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified from this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3), also known as KChIP2.1, lacks an in-frame segment in the coding region, as compared to variant 1. Isoform 3 is thus shorter than isoform 1.

Other Versions

Other products for "KCNIP2"
Frequently bought together (2)
KCNIP2 mouse monoclonal antibody, clone OTI2D2 (formerly 2D2)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones