CEP72 (NM_018140) Human Untagged Clone

CAT#: SC324575

Reviews ()
Write a review

CEP72 (untagged)-Human centrosomal protein 72kDa (CEP72)



  "NM_018140" in other vectors (5)

Reconstitution Protocol

USD 603.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "CEP72"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CEP72
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_018140.3 CCGTTTGAAACATGGCGCGGGCTGGCCCTCGGCTGGTGCTGAGCGAGGAGGCGGTTCGGG
CGAAGAGCGGCTTAGGGCCTCACCGCGACCTGGCTGAGCTTCAGTCATTGTCTATTCCTG
GAACTTACCAAGAGAAGATCACCCACCTGGGACATTCTCTGATGAGTTTAACAGGTCTGA
AATCTTTGGATCTCTCGCGCAACTCCTTGGTTAGTCTGGAGGGCATTCAGTACCTGACTG
CATTGGAGAGTCTCAATCTCTACTACAACTGCATCTCCTCGTTGGCAGAAGTGTTTCGGC
TCCACGCCTTAACCGAGCTCGTGGATGTGGACTTCCGGCTGAACCCCGTGGTGAAGGTTG
AGCCTGACTACCGCCTTTTTGTTGTGCACCTGCTCCCCAAGCTCCAGCAGCTGGACGATC
GCCCCGTGAGAGCAAGCGAGCGGAAGGCTTCCCGACTGCATTTTGCATCAGAGGACTCAC
TCGACTCCAAAGAGAGCGTCCCAGCTTCTTTGAAAGAGGGCAGACCACACCACCCCAGAG
CCAAGTGCACCGAGGCCTTGGCCAAGCAGAGCCTGGTCATGGATGCGGATGACGAGGCAG
TCCTGAACCTCATTGCAGAGTGCGAGTGGGACCTCGGCAGGCCTCCCGGGAGCACGAGCT
TCAGCCAGAAGGGGCGTGAGGCCGACTCTCGTGGTTCCCAAGAATCCAGACATCTGTTGA
GCCCGCAGTTGGTACAGTACCAGTGTGGGGACTCTGGGAAGCAGGGCCGTGAGACGAGGA
GGAGCAGCTGCAGAGGGTGCTGTCTGGAGAAGATGCCTTGGAGCCAGCTCTGTGGAGAGC
TTCCGCCACTGTACGGAGCGGAGCCAGAGGCCTCCCGTGCCCCCAGGCCACACACGTACT
TCACCCCACACCCAGACTCCATGGATACCGAGGACTCGGCCTCTTCTCAGAAGTTGGATT
TGTCAGGAGAAATGGTGCCTGGTCCCCTGCCAGCCCCCGGAAAGTGCAGGAAGCGAAGAA
TGCCTGTTGGAAGATTCCAGACGTTTTCGGACCAGGAGGGTTTGGGCTGCCCGGAGAGAA
CTCATGGGTCCTCCGTGCCCAAGGAGAGCCTGAGCAGACAGGACAGCTCAGAAAGCAGGA
ACGGGAGGACCTTGTCTCAGCCTGAGGCCTCGGAGACTGAGGAGCAGAGGTCTCGGGGTG
TGACCGACACCAGAGAGCCGTCTCCCGGGTCACACTCGGCTCTACCCGGGAAGAAGACGG
CCCTGCAGGCGGCGCTCCTGGAGACGCTCTTGGACCTGGTGGACAGGAGCTGGGGCGGCT
GCAGGTCCCTGCACAGCAACGAGGCATTCCTTGCTCAGGCAAGACACATCTTGTCATCTG
TTGAAGAATTCACAGCAGCTCAGGACAGCTCTGCGATGGTGGGTGAAGATGTCGGCTCCC
TGGCTCTGGAGAGTAAGTCCCTGCAAAGCCGCCTTGCTGAGCAGCAGCAGCAGCACGCCC
GGGAGATGAGCGAGGTGACGGCGGAGCTGCACCACACACACAAGGAGCTGGATGATTTGA
GACAACATTTAGATAAATCTTTGGAAGAGAACAGTAGGTTAAAATCGCTTTTGTTGAGTA
TGAAAAAGGAAGTGAAGAGTGCAGACACTGCAGCCACGTTAAATTTGCAGATCGCTGGAC
TTCAAACAAGTGTGAAGAGGCTGTGTGGCGAGATTGTGGAACTGAAGCAGCACCTGGAGC
ACTACGACAAGATCCAGGAGCTCACGCAGATGCTGCAGGAGAGCCACAGCTCCCTGGTCA
GCACCAATGAACACCTGCTGCAGGAGCTGAGCCAGGTGCGGGCGCAGCACAGAGCCGAGG
TGGAGCAGATGCACTGGAGCTACCAGGAGCTCAAGAAGACCATGGCCCTGTTTCCACACA
GCAGCGCCAGCCATGGAGGCTGCCAGGCCTGCTGACTCCTGCCGAGAAGCTGGGCCACCC
CTTAAGCTTCCTGGTAAAGTTACATTGTCTGCACCTTTGTACTTCTTTATTGAGTGTACT
GGCTGGCAAGAGTTCTCTCTTCTGTTGGTAATTATTTAGGATTTTTGGAATGTATTCAGG
ACCTGTAGCTTGGTTTTCTAAAGCACCTCGTAAAATGATATGATTACTCCAAGCCCTCTG
CATGTTTTCAGACAGAACACATTGACATATTTTGAGACAAACTGACTATTAATCTTGTAT
CCAGTATCCTGAGATGAAGTAAATGCAGTGTTCTACTGCCTGATGTGAAAGAGAGCTATG
TATGATAATTAAAGAAAATAATTTTCTGTGTAACAAGCAATCTTTATTTAATAAACAAAT
ACATTGTTCTGAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_018140
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_018140.3, NP_060610.2
RefSeq Size 2427 bp
RefSeq ORF 1944 bp
Locus ID 55722
UniProt ID Q9P209
Cytogenetics 5p15.33
Gene Summary The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.