ARHGAP11B (NM_001039841) Human Untagged Clone

CAT#: SC324558

ARHGAP11B (untagged)-Human Rho GTPase activating protein 11B (ARHGAP11B)


  "NM_001039841" in other vectors (5)

Reconstitution Protocol

USD 450.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Anti-ARHGAP11B Antibody
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "ARHGAP11B"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ARHGAP11B
Synonyms B'-T; FAM7B1; GAP (1-8)
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001039841.1 GGGGGTCGGGGCCGCAGAAGTGCCAGACGGGGCCGGAAAGCAGCCGAGCGGAGTTCAAAT
TTGAGAGCGTTTGGAAATTGGAAGACTTGGTGGCGAACGAGGGTCAGGACCTGCATCCTG
CCTCAGAGTTATCGACGTATCCGGAATGTGGGATCAGAGGCTGGTGAAGTTGGCCCTGTT
GCAGCATCTGCGGGCCTTCTATGGTATTAAGGTGAAGGGTGTCCGTGGGCAGTGCGATCG
CAGGAGACATGAAACAGCAGCCACGGAAATAGGGGGTAAAATATTTGGAGTACCTTTTAA
TGCACTGCCCCATTCTGCTGTACCAGAATATGGACACATTCCAAGCTTTCTTGTCGATGC
TTGCACATCTTTAGAAGAACATATTCATACCGAAGGGCTTTTTCGGAAATCAGGATCTGT
GATTCGCCTAAAAGCACTAAAGAATAAAGTGGATCATGGTGAAGGTTGCCTATCTTCTGC
ACCTCCTTGTGATATTGCGGGACTTCTTAAGCAGTTTTTTAGGGAACTGCCAGAGCCCAT
TCTCCCAGCTGATTTGCATGAAGCACTTTTGAAAGCTCAACAGTTAGGCACAGAGGAAAA
GAATAAAGCTATACTGTTGCTCTCCTGTCTTCTGGCTGACCACACAGTTCATGTATTAAG
ATACTTCTTTAACTTTCTCAGGAATGTTTCTCTTAGATCCAGTGAGAATAAGATGGATAG
CAGCAATCTTGCAGTAATATTTGCACCAAATCTTCTTCAGACAAGTGAAGGACATGAAAA
GATGTCTTCTAACGCAGAAAAGAAGGGCGTGTACCAGACTTTATCCTGGAAAAGATACCA
GCCATGTTGGGTATTGATGGTCTCTGTGCTACTCCATCACTGGAAGGCTTTGAAGAAGGT
GAATATGAAACTCCTGGTGAATATAAGAGAAAGAGAAGACAACGTGTAGGAGATTTTGTT
AGTGGAGCACTAAATAAATTTAAACCTAACAGAACACCTTCTATTACACCTCAACAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001039841
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001039841.1, NP_001034930.1
RefSeq Size 1045 bp
RefSeq ORF 804 bp
Locus ID 89839
UniProt ID Q3KRB8
Cytogenetics 15q13.2
Gene Summary Hominin-specific protein that promotes development and evolutionary expansion of the brain neocortex (PubMed:25721503). Able to promote amplification of basal progenitors in the subventricular zone, producing more neurons during fetal corticogenesis (PubMed:25721503). Does not possess GTPase activator activity (PubMed:25721503).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the protein-coding transcript.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.