FPR1 (NM_002029) Human Untagged Clone

SKU
SC324418
FPR1 (untagged)-Human formyl peptide receptor 1 (FPR1), transcript variant 2
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FPR1
Synonyms FMLP; FPR
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002029.3 AGAGCCTGAGTCACTCTCCCCAGGAGACCCAGACCTAGAACTACCCAGAGCAAGACCACA
GCTGGTGAACAGTCCAGGAGCAGACAAGATGGAGACAAATTCCTCTCTCCCCACGAACAT
CTCTGGAGGGACACCTGCTGTATCTGCTGGCTATCTCTTCCTGGATATCATCACTTATCT
GGTATTTGCAGTCACCTTTGTCCTCGGGGTCCTGGGCAACGGGCTTGTGATCTGGGTGGC
TGGATTCCGGATGACACACACAGTCACCACCATCAGTTACCTGAACCTGGCCGTGGCTGA
CTTCTGTTTCACCTCCACTTTGCCATTCTTCATGGTCAGGAAGGCCATGGGAGGACATTG
GCCTTTCGGCTGGTTCCTGTGCAAATTCGTCTTTACCATAGTGGACATCAACTTGTTCGG
AAGTGTCTTCCTGATCGCCCTCATTGCTCTGGACCGCTGTGTTTGCGTCCTGCATCCAGT
CTGGACCCAGAACCACCGCACCGTGAGCCTGGCCAAGAAGGTGATCATTGGGCCCTGGGT
GATGGCTCTGCTCCTCACATTGCCAGTTATCATTCGTGTGACTACAGTACCTGGTAAAAC
GGGGACAGTAGCCTGCACTTTTAACTTTTCGCCCTGGACCAACGACCCTAAAGAGAGGAT
AAATGTGGCCGTTGCCATGTTGACGGTGAGAGGCATCATCCGGTTCATCATTGGCTTCAG
CGCACCCATGTCCATCGTTGCTGTCAGTTATGGGCTTATTGCCACCAAGATCCACAAGCA
AGGCTTGATTAAGTCCAGTCGTCCCTTACGGGTCCTCTCCTTTGTCGCAGCAGCCTTTTT
TCTCTGCTGGTCCCCATATCAGGTGGTGGCCCTTATAGCCACAGTCAGAATCCGTGAGTT
ATTGCAAGGCATGTACAAAGAAATTGGTATTGCAGTGGATGTGACAAGTGCCCTGGCCTT
CTTCAACAGCTGCCTCAACCCCATGCTCTATGTCTTCATGGGCCAGGACTTCCGGGAGAG
GCTGATCCACGCCCTTCCCGCCAGTCTGGAGAGGGCCCTGACCGAGGACTCAACCCAAAC
TAGTGACACAGCTACCAATTCTACTTTACCTTCTGCAGAGGTGGAGTTACAGGCAAAGTG
AGGAGGGAGCTGGGGGACACTTTCGAGCTCCCAGCTCCAGCTTCGTCTCACCTTGAGTTA
GGCTGAGCCACAGGCATTTCCTGCTTATTTTAGGATTACCCACTCATCAGAAAAAAAAAA
AAAAGCCTTTGTGTCCCCTGATTTGGGGAGAATAAACAGATATGAGTCCAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_002029
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002029.3, NP_002020.1
RefSeq Size 1334 bp
RefSeq ORF 1053 bp
Locus ID 2357
UniProt ID P21462
Cytogenetics 19q13.41
Domains 7tm_1
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Summary This gene encodes a G protein-coupled receptor of mammalian phagocytic cells that is a member of the G-protein coupled receptor 1 family. The protein mediates the response of phagocytic cells to invasion of the host by microorganisms and is important in host defense and inflammation.[provided by RefSeq, Jul 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.
Write Your Own Review
You're reviewing:FPR1 (NM_002029) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202745 FPR1 (Myc-DDK-tagged)-Human formyl peptide receptor 1 (FPR1), transcript variant 2 10 ug
$289.00 MSRP $686.00 MSRP $686.00
RC202745L1 Lenti ORF clone of Human formyl peptide receptor 1 (FPR1), transcript variant 2, Myc-DDK-tagged 10 ug
$986.00
RC202745L2 Lenti ORF clone of Human formyl peptide receptor 1 (FPR1), transcript variant 2, mGFP tagged 10 ug
$986.00
RC202745L3 Lenti ORF clone of Human formyl peptide receptor 1 (FPR1), transcript variant 2, Myc-DDK-tagged 10 ug
$986.00
RC202745L4 Lenti ORF clone of Human formyl peptide receptor 1 (FPR1), transcript variant 2, mGFP tagged 10 ug
$986.00
RG202745 FPR1 (tGFP-tagged) - Human formyl peptide receptor 1 (FPR1), transcript variant 2 10 ug
$489.00 MSRP $886.00 MSRP $886.00
SC118857 FPR1 (untagged)-Human formyl peptide receptor 1 (FPR1), transcript variant 2 10 ug
$686.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.