hnRNP G (RBMX) (NM_002139) Human Untagged Clone

CAT#: SC324390

Reviews ()
Write a review

RBMX (untagged)-Human RNA binding motif protein, X-linked (RBMX), transcript variant 1



Reconstitution Protocol

USD 457.00

In Stock*

Size
    • 10 ug

Product images

Other products for "RBMX"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RBMX
Synonyms hnRNP-G; HNRNPG; HNRPG; MRXS11; RBMXP1; RBMXRT; RNMX
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_002139.2 CAGTAGTGCTAGCGGCTTCGCGGTTCGGTCCTCGCACCCGGCAGCCGCCACTGGTGCTGA
GCTGCTAGGAAGCCCCTATCGCCGAGCTCGTTGGAGCTTGAACCCATTGTCACCCCTCCG
ACTCACCGGCCCAAAAAAAAAAAAAAATGGTTGAAGCAGATCGCCCAGGAAAGCTCTTCA
TTGGTGGGCTTAATACGGAAACAAATGAGAAAGCTCTTGAAGCAGTATTTGGCAAATATG
GACGAATAGTGGAAGTACTCTTGATGAAAGACCGTGAAACCAACAAATCAAGAGGATTTG
CTTTTGTCACCTTTGAAAGCCCAGCAGACGCTAAGGATGCAGCCAGAGACATGAATGGAA
AGTCATTAGATGGAAAAGCCATCAAGGTGGAACAAGCCACCAAACCATCATTTGAAAGTG
GTAGACGTGGACCGCCTCCACCTCCAAGAAGTAGAGGCCCTCCAAGAGGTCTTAGAGGTG
GAAGAGGAGGAAGTGGAGGAACCAGGGGACCTCCCTCACGGGGAGGACACATGGATGACG
GTGGATATTCCATGAATTTTAACATGAGTTCTTCCAGGGGACCACTCCCAGTAAAAAGAG
GACCACCACCAAGAAGTGGGGGTCCTCCTCCTAAGAGATCTGCACCTTCAGGACCAGTTC
GCAGTAGCAGTGGAATGGGAGGAAGAGCTCCTGTATCACGTGGAAGAGATAGTTATGGAG
GTCCACCTCGAAGGGAACCGCTGCCCTCTCGTAGAGATGTTTATTTGTCCCCAAGAGATG
ATGGGTATTCTACTAAAGACAGCTATTCAAGCAGAGATTACCCAAGTTCTCGTGATACTA
GAGATTATGCACCACCACCACGAGATTATACTTACCGTGATTATGGTCATTCCAGTTCAC
GTGATGACTATCCATCAAGAGGATATAGCGATAGAGATGGATATGGTCGTGATCGTGACT
ATTCAGATCATCCAAGTGGAGGTTCCTACAGAGATTCATATGAGAGTTATGGTAACTCAC
GTAGTGCTCCACCTACACGAGGGCCCCCGCCATCTTATGGTGGAAGCAGTCGCTATGATG
ATTACAGCAGCTCACGTGACGGATATGGTGGAAGTCGAGACAGTTACTCAAGCAGCCGAA
GTGATCTCTACTCAAGTGGTCGTGATCGGGTTGGCAGACAAGAAAGAGGGCTTCCCCCTT
CTATGGAAAGGGGGTACCCTCCTCCACGTGATTCCTACAGCAGTTCAAGCCGCGGAGCAC
CAAGAGGTGGTGGCCGTGGAGGAAGCCGATCTGATAGAGGGGGAGGCAGAAGCAGATACT
AGAAACAAACAAAACTTTGGACCAAAATCCCAGTTCAAAGAAACAAAAAGTGGAAACTAT
TCTATCATAACTACCCAAGGACTACTAAAAGGAAAAATTGTGTTACTTTTTTTAAATTCC
CTGTTAAGTTCCCCTCCATAATTTTTATGTTCTTGTGAGGAAAAAAGTAAAACATGTTTA
ATTTTATTTGACTTTCGCATTGCTTTTCAACAAGCAAATGTTAAATGTGTTAAGACTTGT
ACTAGTGTTGTAACTTTCCAAGTAAAAGTATCCCCTAAAGGCCACTTCCTATCTGATTTT
TCCCAGCAAATGAGGCAGGCAATTCTAAGATCTTCCACAAAACATCTAGCCATCTAAAAT
GGAGAGATGAATCATTCTACCTATACAAACAAGCTAGCTATTAGAGGGTGGTTGGGGTAT
GCTACTCATAAGATTTCAGGGTGTCTTCCAACTGAAATCTCAATGTTCTCAGTACGAAAA
ACCTGAAATCACATGCCTATGTAAGGAAAGTGCTATTCACCCAGTAAACCCAAAAAAGCA
AATGGATAATGCTGGCCATTTTGCCTTTCTGACATTTCCTTGGGAATCTGCAAGAACCTC
CCCTTTCCCTTCCCCCAATAAGACCATTTAAGTGTGTGTTAAACAACTACAGAATACTAA
ATAAAAAGTTTGGCCAAAACCAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_002139
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002139.2, NP_002130.2
RefSeq Size 2078 bp
RefSeq ORF 1176 bp
Locus ID 27316
UniProt ID P38159
Cytogenetics Xq26.3
Domains RRM, RRM_1
Protein Pathways Spliceosome
Gene Summary This gene belongs to the RBMY gene family which includes candidate Y chromosome spermatogenesis genes. This gene, an active X chromosome homolog of the Y chromosome RBMY gene, is widely expressed whereas the RBMY gene evolved a male-specific function in spermatogenesis. Pseudogenes of this gene, found on chromosomes 1, 4, 9, 11, and 6, were likely derived by retrotransposition from the original gene. Alternatively spliced transcript variants encoding different isoforms have been identified. A snoRNA gene (SNORD61) is found in one of its introns. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (1) represents the more frequently occurring transcript and it encodes the longer protein (isoform 1).
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.