Nucleophosmin (NPM1) (NM_199185) Human Untagged Clone

CAT#: SC324072

NPM1 (untagged)-Human nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1), transcript variant 2


  "NM_199185" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
NPM1 Rabbit polyclonal Antibody
    • 100 ul

USD 313.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nucleophosmin"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Nucleophosmin
Synonyms B23; NPM
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_199185.2 CGGACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGTGTGATTCCGTCCTGCGCGGTTGT
TCTCTGGAGCAGCGTTCTTTTATCTCCGTCCGCCTTCTCTCCTACCTAAGTGCGTGCCGC
CACCCGATGGAAGATTCGATGGACATGGACATGAGCCCCCTGAGGCCCCAGAACTATCTT
TTCGGTTGTGAACTAAAGGCCGACAAAGATTATCACTTTAAGGTGGATAATGATGAAAAT
GAGCACCAGTTATCTTTAAGAACGGTCAGTTTAGGGGCTGGTGCAAAGGATGAGTTGCAC
ATTGTTGAAGCAGAGGCAATGAATTACGAAGGCAGTCCAATTAAAGTAACACTGGCAACT
TTGAAAATGTCTGTACAGCCAACGGTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTG
GTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAGCT
GTGGAGGAAGATGCAGAGTCAGAAGATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATA
TCTGGAAAGCGGTCTGCCCCTGGAGGTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTT
GCTGCTGATGAAGATGATGACGATGATGATGAAGAGGATGATGATGAAGATGATGATGAT
GATGATTTTGATGATGAGGAAGCTGAAGAAAAAGCGCCAGTGAAGAAAGGACAAGAATCC
TTCAAGAAACAGGAAAAAACTCCTAAAACACCAAAAGGACCTAGTTCTGTAGAAGACATT
AAAGCAAAAATGCAAGCAAGTATAGAAAAAGGTGGTTCTCTTCCCAAAGTGGAAGCCAAA
TTCATCAATTATGTGAAGAATTGCTTCCGGATGACTGACCAAGAGGCTATTCAAGATCTC
TGGCAGTGGAGGAAGTCTCTTTAAGAAAATAGTTTAAACAATTTGTTAAAAAATTTTCCG
TCTTATTTCATTTCTGTAACAGTTGATATCTGGCTGTCCTTTTTATAATGCAGAGTGAGA
ACTTTCCCTACCGTGTTTGATAAATGTTGTCCAGGTTCTATTGCCAAGAATGTGTTGTCC
AAAATGCCGTTTAGTTTTTAAAGATGGAACTCCACCCTTTGCTTGGTTTTAAGTATGTAT
GGAATGTTATGATAGGACATAGTAGTAGCGGTGGTCAGACATGGAAATGGTGGGGAGACA
AAAATATACATGTGAAATAAAACTCAGTATTTTAATAAAGTAAAAAAAAAAAAAAA
Restriction Sites ECoRI-NOT     
ACCN NM_199185
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_199185.2, NP_954654.1
RefSeq Size 1286 bp
RefSeq ORF 798 bp
Locus ID 4869
UniProt ID P06748
Cytogenetics 5q35.1
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Gene Summary The protein encoded by this gene is involved in several cellular processes, including centrosome duplication, protein chaperoning, and cell proliferation. The encoded phosphoprotein shuttles between the nucleolus, nucleus, and cytoplasm, chaperoning ribosomal proteins and core histones from the nucleus to the cytoplasm. This protein is also known to sequester the tumor suppressor ARF in the nucleolus, protecting it from degradation until it is needed. Mutations in this gene are associated with acute myeloid leukemia. Dozens of pseudogenes of this gene have been identified. [provided by RefSeq, Aug 2017]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2) that lacks an internal segment, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.