RPS14 (NM_001025070) Human Untagged Clone

SKU
SC323747
RPS14 (untagged)-Human ribosomal protein S14 (RPS14), transcript variant 2
$150.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RPS14
Synonyms EMTB; S14
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001025070.1 GGCCCGGGCGCGACAATCGGGGGGCATCCTGCGGCGAGGGGACCCTGTGGGGCTTGGGAC
GAGAGACGGGGGTCTTTCCGTGGGAACCGAGCTAGGTGCCGGGCAAGAGACGCGCGGCTG
GCCCACCTGGATCCTGGCCAACTCGGGATTGAGTTCGTTCCTGGTCTCAGAAGGCCCGTT
TTGCTTCAGGGAGGAGCTTGTGAAAAATGGCACCTCGAAAGGGGAAGGAAAAGAAGGAAG
AACAGGTCATCAGCCTCGGACCTCAGGTGGCTGAAGGAGAGAATGTATTTGGTGTCTGCC
ATATCTTTGCATCCTTCAATGACACTTTTGTCCATGTCACTGATCTTTCTGGCAAAGAAA
CCATCTGCCGTGTGACTGGTGGGATGAAGGTAAAGGCAGACCGAGATGAATCCTCACCAT
ATGCTGCTATGTTGGCTGCCCAGGATGTGGCCCAGAGGTGCAAGGAGCTGGGTATCACCG
CCCTACACATCAAACTCCGGGCCACAGGAGGAAATAGGACCAAGACCCCTGGACCTGGGG
CCCAGTCGGCCCTCAGAGCCCTTGCCCGCTCGGGTATGAAGATCGGGCGGATTGAGGATG
TCACCCCCATCCCCTCTGACAGCACTCGCAGGAAGGGGGGTCGCCGTGGTCGCCGTCTGT
GAACAAGATTCCTCAAAATATTTTCTGTTAATAAATTGCCTTCATGTAAACTGTTAAAAA
AAAAAAAAAA
Restriction Sites ECoRI-NOT
ACCN NM_001025070
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001025070.1, NP_001020241.1
RefSeq Size 787 bp
RefSeq ORF 456 bp
Locus ID 6208
UniProt ID P62263
Cytogenetics 5q33.1
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S11P family of ribosomal proteins. It is located in the cytoplasm. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. In Chinese hamster ovary cells, mutations in this gene can lead to resistance to emetine, a protein synthesis inhibitor. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks a small segment in the 5' UTR, as compared to variant 1. Variants 1-3 encode the same protein.
Write Your Own Review
You're reviewing:RPS14 (NM_001025070) Human Untagged Clone
Your Rating
SKU Description Size Price
RC203889 RPS14 (Myc-DDK-tagged)-Human ribosomal protein S14 (RPS14), transcript variant 2 10 ug
$150.00
RC203889L1 Lenti ORF clone of Human ribosomal protein S14 (RPS14), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC203889L2 Lenti ORF clone of Human ribosomal protein S14 (RPS14), transcript variant 2, mGFP tagged 10 ug
$450.00
RC203889L3 Lenti ORF clone of Human ribosomal protein S14 (RPS14), transcript variant 2, Myc-DDK-tagged 10 ug
$450.00
RC203889L4 Lenti ORF clone of Human ribosomal protein S14 (RPS14), transcript variant 2, mGFP tagged 10 ug
$450.00
RG203889 RPS14 (tGFP-tagged) - Human ribosomal protein S14 (RPS14), transcript variant 2 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.