GABA A Receptor alpha 1 (GABRA1) (NM_001127647) Human Untagged Clone

SKU
SC323076
GABRA1 (untagged)-Human gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), transcript variant 6
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GABA A Receptor alpha 1
Synonyms ECA4; EJM; EJM5
Vector pCMV6 series
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001127647, the custom clone sequence may differ by one or more nucleotides
ATGAGGAAAAGTCCAGGTCTGTCTGACTGTCTTTGGGCCTGGATCCTCCTTCTGAGCACA
CTGACTGGAAGAAGCTATGGACAGCCGTCATTACAAGATGAACTTAAAGACAATACCACT
GTCTTCACCAGGATTTTGGACAGACTCCTAGATGGTTATGACAATCGCCTGAGACCAGGA
TTGGGAGAGCGTGTAACCGAAGTGAAGACTGATATCTTCGTCACCAGTTTCGGACCCGTT
TCAGACCATGATATGGAATATACAATAGATGTATTTTTCCGTCAAAGCTGGAAGGATGAA
AGGTTAAAATTTAAAGGACCTATGACAGTCCTCCGGTTAAATAACCTAATGGCAAGTAAA
ATCTGGACTCCGGACACATTTTTCCACAATGGAAAGAAGTCAGTGGCCCACAACATGACC
ATGCCCAACAAACTCCTGCGGATCACAGAGGATGGCACCTTGCTGTACACCATGAGGCTG
ACAGTGAGAGCTGAATGTCCGATGCATTTGGAGGACTTCCCTATGGATGCCCATGCTTGC
CCACTAAAATTTGGAAGTTATGCTTATACAAGAGCAGAAGTTGTTTATGAATGGACCAGA
GAGCCAGCACGCTCAGTGGTTGTAGCAGAAGATGGATCACGTCTAAACCAGTATGACCTT
CTTGGACAAACAGTAGACTCTGGAATTGTCCAGTCAAGTACAGGAGAATATGTTGTTATG
ACCACTCATTTCCACTTGAAGAGAAAGATTGGCTACTTTGTTATTCAAACATACCTGCCA
TGCATAATGACAGTGATTCTCTCACAAGTCTCCTTCTGGCTCAACAGAGAGTCTGTACCA
GCAAGAACTGTCTTTGGAGTAACAACTGTGCTCACCATGACAACATTGAGCATCAGTGCC
AGAAACTCCCTCCCTAAGGTGGCTTATGCAACAGCTATGGATTGGTTTATTGCCGTGTGC
TATGCCTTTGTGTTCTCAGCTCTGATTGAGTTTGCCACAGTAAACTATTTCACTAAGAGA
GGTTATGCATGGGATGGCAAAAGTGTGGTTCCAGAAAAGCCAAAGAAAGTAAAGGATCCT
CTTATTAAGAAAAACAACACTTACGCTCCAACAGCAACCAGCTACACCCCTAATTTGGCC
AGGGGCGACCCGGGCTTAGCCACCATTGCTAAAAGTGCAACCATAGAACCTAAAGAGGTC
AAGCCCGAAACAAAACCACCAGAACCCAAGAAAACCTTTAACAGTGTCAGCAAAATTGAC
CGACTGTCAAGAATAGCCTTCCCGCTGCTATTTGGAATCTTTAACTTAGTCTACTGGGCT
ACGTATTTAAACAGAGAGCCTCAGCTAAAAGCCCCCACACCACATCAA
Restriction Sites Please inquire
ACCN NM_001127647
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001127647.1, NP_001121119.1
RefSeq Size 4223 bp
RefSeq ORF 1371 bp
Locus ID 2554
Cytogenetics 5q34
Protein Families Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Summary This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. Mutations in this gene cause juvenile myoclonic epilepsy and childhood absence epilepsy type 4. Multiple transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) differs in the 5' UTR, compared to variant 1. Variants 1-7 encode the same protein.
Write Your Own Review
You're reviewing:GABA A Receptor alpha 1 (GABRA1) (NM_001127647) Human Untagged Clone
Your Rating
SKU Description Size Price
RC225756 GABRA1 (Myc-DDK-tagged)-Human gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), transcript variant 6 10 ug
$457.00
RC225756L3 Lenti-ORF clone of GABRA1 (Myc-DDK-tagged)-Human gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), transcript variant 6 10 ug
$757.00
RC225756L4 Lenti-ORF clone of GABRA1 (mGFP-tagged)-Human gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), transcript variant 6 10 ug
$757.00
RG225756 GABRA1 (tGFP-tagged) - Human gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), transcript variant 6 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.