Lysosomal acid lipase (LIPA) (NM_001127605) Human Untagged Clone

CAT#: SC323024

LIPA (untagged)-Human lipase A, lysosomal acid, cholesterol esterase (LIPA), transcript variant 1


  "NM_001127605" in other vectors (6)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
Rabbit Polyclonal Lipase A Antibody
    • 100 ul

USD 550.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Lysosomal acid lipase"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Lysosomal acid lipase
Synonyms CESD; LAL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001127605 edited
ATGAAAATGCGGTTCTTGGGGTTGGTGGTCTGTTTGGTTCTCTGGCCCCTGCATTCTGAG
GGGTCTGGAGGGAAACTGACAGCTTTGGATCCTGAAACAAACATGAATGTGAGTGAAATT
ATCTCTTACTGGGGATTCCCTAGTGAGGAATACCTAGTTGAGACAGAAGATGGATATATT
CTGTGCCTTAACCGAATTCCTCATGGGAGGAAGAACCATTCTGACAAAGGTCCCAAACCA
GTTGTCTTCCTGCAACATGGCTTGCTGGCAGATTCTAGTAACTGGGTCACAAACCTTGCC
AACAGCAGCCTGGGCTTCATTCTTGCTGATGCTGGTTTTGACGTGTGGATGGGCAACAGC
AGAGGAAATACCTGGTCTCGGAAACATAAGACACTCTCAGTTTCTCAGGATGAATTCTGG
GCTTTCAGTTATGATGAGATGGCAAAATATGACCTACCAGCTTCCATTAACTTCATTCTG
AATAAAACTGGCCAAGAACAAGTGTATTATGTGGGTCATTCTCAAGGCACCACTATAGGT
TTTATAGCATTTTCACAGATCCCTGAGCTGGCTAAAAGGATTAAAATGTTTTTTGCCCTG
GGTCCTGTGGCTTCCGTCGCCTTCTGTACTAGCCCTATGGCCAAATTAGGACGATTACCA
GATCATCTCATTAAGGACTTATTTGGAGACAAAGAATTTCTTCCCCAGAGTGCGTTTTTG
AAGTGGCTGGGTACCCACGTTTGCACTCATGTCATACTGAAGGAGCTCTGTGGAAATCTC
TGTTTTCTTCTGTGTGGATTTAATGAGAGAAATTTAAATATGTCTAGAGTGGATGTATAT
ACAACACATTCTCCTGCTGGAACTTCTGTGCAAAACATGTTACACTGGAGCCAGGCTGTT
AAATTCCAAAAGTTTCAAGCCTTTGACTGGGGAAGCAGTGCCAAGAATTATTTTCATTAC
AACCAGAGTTATCCTCCCACATACAATGTGAAGGACATGCTTGTGCCGACTGCAGTCTGG
AGCGGGGGTCACGACTGGCTTGCAGATGTCTACGACGTCAATATCTTACTGACTCAGATC
ACCAACTTGGTGTTCCATGAGAGCATTCCGGAATGGGAGCATCTTGACTTCATTTGGGGC
CTGGATGCCCCTTGGAGGCTTTATAATAAAATTATTAATCTAATGAGGAAATATCAGTGA
Restriction Sites Please inquire     
ACCN NM_001127605
Insert Size 1200 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001127605.1, NP_001121077.1
RefSeq Size 2669 bp
RefSeq ORF 1200 bp
Locus ID 3988
UniProt ID P38571
Cytogenetics 10q23.31
Protein Families Druggable Genome
Protein Pathways Lysosome, Steroid biosynthesis
Gene Summary This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (1) encodes the longest isoform (1). Variants 1 and 2 encode the same isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.