PSMG4 (NM_001128591) Human Untagged Clone
SKU
SC322827
PSMG4 (untagged)-Human proteasome (prosome, macropain) assembly chaperone 4 (PSMG4), transcript variant 2
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | PSMG4 |
Synonyms | bA506K6.2; C6orf86; PAC4 |
Vector | pCMV6 series |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001128591, the custom clone sequence may differ by one or more nucleotides
ATGGAGGGGCTGGTTGTCGCCGCCGGCGGGGACGTCTCCCTGCACAACTTCAGCGCGAGG CTGTGGGAGCAGCTGGTCCACTTCCACGTCATGCGGCTGACGGACTCGCTGTTCCTGTGG GTGGGGGCCACGCCGCACCTGCGCAACCTCGCCGTGGCCATGTGCAGCCGCTACGACTCC ATCCCCGTGTCTACCTCCCTCCTTGGAGACACTTCCGACACGACCTCTACTGGCCTTGCC CAGCGCCTAGCCAGGAAGACCAACAAACAGGTGTTTGTCAGCTATAACCTTCAGAACACA GACAGTAACTTCGCATTACTTGTAGAAAACAGGATCAAGGAAGAGATGGAGGCTTTCCCC GAAAAGTTC |
Restriction Sites | Please inquire |
ACCN | NM_001128591 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001128591.1, NP_001122063.1 |
RefSeq Size | 821 bp |
RefSeq ORF | 372 bp |
Locus ID | 389362 |
UniProt ID | Q5JS54 |
Cytogenetics | 6p25.2 |
Summary | Chaperone protein which promotes assembly of the 20S proteasome.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the mid-coding region, compared to variant 1, resulting in an isoform (b) that is shorter than isoform a. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC225070 | PSMG4 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) assembly chaperone 4 (PSMG4), transcript variant 2 | 10 ug |
$165.00
|
|
RC225070L3 | Lenti-ORF clone of PSMG4 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) assembly chaperone 4 (PSMG4), transcript variant 2 | 10 ug |
$465.00
|
|
RC225070L4 | Lenti-ORF clone of PSMG4 (mGFP-tagged)-Human proteasome (prosome, macropain) assembly chaperone 4 (PSMG4), transcript variant 2 | 10 ug |
$465.00
|
|
RG225070 | PSMG4 (tGFP-tagged) - Human proteasome (prosome, macropain) assembly chaperone 4 (PSMG4), transcript variant 2 | 10 ug |
$365.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.