Cullin 3(CUL3) (NM_003590) Human Untagged Clone

CAT#: SC322625

CUL3 (untagged)-Human cullin 3 (CUL3)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cullin 3(CUL3) (NM_003590) Human Untagged Clone
Symbol CUL3
Synonyms CUL-3; PHA2E
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322625 CCGGCGCAGTGAGATGTTTGTCCGTCGCCGCCGCCGCCGCCATCGCGGAGGAGCGCGATA
AAGGGAGCCGAGCCGGACGTGAGGGGGACCCCGCGGAGCCGCCGCGCCAGCGCAGCCCCC
CAGCCGCATCGGAGTCGCCAGAGTCCGAGCCGCCGCCGCCGCCGCCCCCGCCGCCGCCGC
GGCTGCCCAGGGGCCGGCCAGCTCCCCAGCCCTGCCCGGGGGTCGCGCCGCCGCCGCCCC
CAGCGTCGCCCCTAGCCTGCCTGCCCGCCTTAAATGTGACACCGGCGTCGCGGAGCGCGA
CCTGAAGCCGCCGCCGGGGAGGGGACGAGCACCATGTCGAATCTGAGCAAAGGCACGGGC
AGCCGGAAGGACACCAAGATGCGGATCCGGGCCTTTCCGATGACCATGGATGAAAAATAT
GTAAACAGCATTTGGGACCTTCTGAAAAATGCAATTCAAGAAATCCAGCGTAAGAATAAC
AGTGGTCTTAGTTTTGAGGAGCTCTATAGAAATGCATATACAATGGTTTTGCATAAACAT
GGAGAAAAGCTCTACACTGGACTAAGAGAAGTTGTTACCGAACATCTCATAAATAAGGTG
CGAGAAGATGTACTAAATTCATTGAATAACAACTTTCTTCAAACGCTAAATCAAGCTTGG
AATGATCATCAAACAGCTATGGTGATGATTAGAGACATACTAATGTACATGGACCGTGTG
TATGTACAACAAAATAATGTGGAGAACGTCTACAATTTGGGATTAATTATTTTTCGAGAT
CAAGTTGTACGTTATGGGTGTATTAGGGATCATCTACGGCAAACTCTATTGGATATGATT
GCAAGAGAGCGGAAAGGAGAAGTCGTAGACAGAGGCGCAATAAGAAATGCTTGCCAGATG
TTAATGATTTTAGGTCTCGAAGGAAGATCAGTCTATGAAGAAGATTTTGAGGCTCCTTTT
TTGGAAATGTCTGCAGAATTTTTTCAGATGGAAAGCCAGAAATTTTTAGCAGAAAATAGT
GCTTCAGTATATATAAAGAAAGTAGAAGCTAGAATTAATGAAGAAATAGAACGAGTGATG
CACTGCCTTGACAAATCAACGGAAGAACCAATTGTAAAGGTGGTTGAAAGGGAACTCATT
TCCAAGCACATGAAGACTATAGTAGAAATGGAGAATTCTGGGCTAGTACATATGTTGAAA
AATGGAAAGACAGAAGACCTTGGTTGCATGTACAAGTTATTTAGTCGTGTGCCAAATGGT
TTGAAAACAATGTGTGAGTGTATGAGTTCCTATTTGAGGGAGCAAGGTAAAGCTCTTGTT
TCTGAAGAAGGAGAAGGAAAGAATCCTGTTGACTATATCCAGGGCTTATTGGATCTGAAG
AGTAGGTTCGATCGCTTCCTCCTGGAATCATTCAACAATGACCGTCTCTTTAAACAAACT
ATTGCGGGTGACTTTGAGTATTTTCTCAACCTCAACTCCAGGTCTCCTGAATACCTCTCA
TTATTTATTGATGATAAGCTGAAAAAGGGAGTCAAAGGGCTAACAGAACAAGAAGTAGAA
ACAATATTGGATAAAGCAATGGTCCTTTTTAGGTTTATGCAAGAAAAAGATGTATTTGAA
CGTTATTATAAACAACACTTGGCAAGGAGACTTCTCACAAATAAAAGTGTTTCTGATGAC
TCTGAAAAAAACATGATATCTAAGTTAAAGACTGAATGTGGATGTCAGTTCACGTCAAAA
CTGGAAGGAATGTTTAGGGATATGAGCATCTCAAACACAACGATGGATGAATTCAGGCAA
CATCTACAGGCAACTGGTGTATCTTTAGGTGGTGTTGATCTTACAGTCCGGGTGCTCACG
ACAGGATATTGGCCCACTCAGTCAGCCACACCAAAGTGCAACATCCCACCAGCACCAAGA
CATGCTTTTGAGATATTCAGAAGGTTCTACTTAGCCAAACACAGTGGTCGACAGCTCACA
CTCCAGCATCATATGGGTTCTGCAGATCTCAATGCCACATTTTATGGACCAGTTAAAAAG
GAAGATGGATCTGAAGTTGGTGTTGGAGGTGCACAAGTAACTGGCTCTAATACACGGAAG
CACATATTGCAAGTTTCCACTTTCCAGATGACCATATTAATGCTCTTTAATAATAGAGAA
AAATACACATTTGAGGAAATTCAGCAAGAGACAGATATCCCTGAAAGAGAGCTTGTTAGA
GCCCTACAGTCCCTCGCCTGTGGTAAACCAACACAGCGGGTTCTTACAAAAGAACCCAAA
TCAAAGGAAATAGAAAATGGTCATATATTTACAGTTAATGATCAGTTCACATCCAAACTA
CACAGAGTCAAGATTCAAACAGTTGCTGCCAAACAAGGTGAATCCGACCCAGAGAGGAAA
GAAACAAGGCAGAAAGTAGACGACGACAGAAAACATGAGATAGAAGCTGCTATAGTGCGG
ATAATGAAATCTAGAAAGAAGATGCAGCACAATGTTCTAGTAGCGGAGGTAACTCAGCAG
TTGAAGGCGCGATTCTTACCAAGTCCAGTTGTTATTAAGAAACGTATTGAAGGACTTATT
GAGAGAGAATATTTGGCACGAACACCTGAGGATCGCAAAGTATACACATATGTAGCATAA
AATGCGTTCAGAAATTTGATTTATTCTTGGACTGTACTCTTCGCATGGACTGGGAAGTTC
TTTTAAATCATTAAATATTAAGACGACCATCTCTTCTATTAAATTACAGTACATGTTCTA
GACCATTGAGATCAAGCCTTTACTCCCTTTGAGAGTTTCCAACATCAGTTGATTGAGCTT
CAGGCTTTACAACGTTTATCCCTGTAGAGATCATCTTTACAGTTCCTCGGGAAAATGTGA
ATGTGCTGCGTTTTGTTTTCTTTACTGTATGAAAACAGGAAAATAAAAGAGAAATTTAGA
AAATACAGCTCATTACAATAAAATTGTTGGATTTCAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for SC322625 unedited
GTACGTACCATATGTATACGACTCCTATAGGGCGGAAGAAAAAACGCGGGCGCCGGTACC
GGTCCGGAAAAAAAGGGATATCGTCGACCCACGCGTCCGCCCACGCGTCCGGCGCAGTGA
GATGTTGGTCCGTCGCTTTCCGCCGACGCCAGCGGGGAGGAGCGCGATAAAGGGAGCCGA
GCCGGACGTGAGGGGGACCCGGCCGAGCCGCCGCGCCGGCACAGCCCCCCACCCGCATCG
GAGTCGCCAGAGTCCGAACCGCCGCCGACGACGCCCCCGGCGTCGCCGCGGCTGCCCAGG
GGCCGCCCGCTCCCCGCCCTGCCCGGGGGTCGCGCCGCGGACGCCCCCAGCAACACCCCT
TTCCTGCCTGCCCGGCTTAAATGTGACACCGGCGTCTTGGATCGCTACCAGAAGCCCTCG
CCTGGGAGGGGACGATCACCATGTCGTATCTCAGCAAGGCACGGGCCGACGGAAGGACCC
TAAGATGCGGATGCCGCCCCTGTCCGAGGACCCTGGGATGAAAAGACATGTGTAACCCTT
TTTCGGGGACCTTTCAGAAAAAGGCTCTTCCCAGAGAATCCAAGGAAAAAATAACCAGCG
GGTCTTAGGTCTGAGGGACCTGTATTAAAATGCCATACGGGTGGGTTTGGGCTAACCCCT
GGTGTAAAAGCTTTCTCCCGGGTCTTAAAAAAAATTCTTTTCCCGACCCTCTCTTTAACT
AAGGAGCCAAAAAGAGGGTACCTCAAATCTCGTTGAATATCCACTTGTTTTAAACACCTT
AAATCAACCCTTGGCATTTTATCCTTCTAACACTTTTGGGGGTGTGGATTTTACAAAACA
TCCGAATGGATCCCTGGCACCCGTGGTCTTGTCAACACAGCACAATATGGTGGGGAAAAC
AGGTCTCA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_003590
ORF Size 2307 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003590.2, NP_003581
RefSeq Size 6787
RefSeq ORF 2307
Locus ID 8452
Cytogenetics 2q36.2
Domains Cullin
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary This gene encodes a member of the cullin protein family. The encoded protein plays a critical role in the polyubiquitination and subsequent degradation of specific protein substrates as the core component and scaffold protein of an E3 ubiquitin ligase complex. Complexes including the encoded protein may also play a role in late endosome maturation. Mutations in this gene are a cause of type 2E pseudohypoaldosteronism. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012].
Transcript Variant: This variant (1) encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.