ATP5F1B (NM_001686) Human Untagged Clone
CAT#: SC322509
ATP5B (untagged)-Human ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), nuclear gene encoding mitochondrial protein
"NM_001686" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ATP5F1B |
Synonyms | ATP5B; ATPMB; ATPSB; HEL-S-271 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322509
GGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTT
GCGGAGACTCACCCCTTCAGCGTCGCTGCCCCCAGCTCAGCTCTTACTGCGGGCCGCTCC GACGGCGGTCCATCCTGTCAGGGACTATGCGGCGCAAACATCTCCTTCGCCAAAAGCAGG CGCCGCCACCGGGCGCATCGTGGCGGTCATTGGCGCAGTGGTGGACGTCCAGTTTGATGA GGGACTACCACCAATTCTAAATGCCCTGGAAGTGCAAGGCAGGGAGACCAGACTGGTTTT GGAGGTGGCCCAGCATTTGGGTGAGAGCACAGTAAGGACTATTGCTATGGATGGTACAGA AGGCTTGGTTAGAGGCCAGAAAGTACTGGATTCTGGTGCACCAATCAAAATTCCTGTTGG TCCTGAGACTTTGGGCAGAATCATGAATGTCATTGGAGAACCTATTGATGAAAGAGGTCC CATCAAAACCAAACAATTTGCTCCCATTCATGCTGAGGCTCCAGAGTTCATGGAAATGAG TGTTGAGCAGGAAATTCTGGTGACTGGTATCAAGGTTGTCGATCTGCTAGCTCCCTATGC CAAGGGTGGCAAAATTGGGCTTTTTGGTGGTGCTGGAGTTGGCAAGACTGTACTGATCAT GGAGTTAATCAACAATGTCGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGG TGAGAGGACCCGTGAAGGCAATGATTTATACCATGAAATGATTGAATCTGGTGTTATCAA CTTAAAAGATGCCACCTCTAAGGTAGCGCTGGTATATGGTCAAATGAATGAACCACCTGG TGCTCGTGCCCGGGTAGCTCTGACTGGGCTGACTGTGGCTGAATACTTCAGAGACCAAGA AGGTCAAGATGTACTGCTATTTATTGATAACATCTTTCGCTTCACCCAGGCTGGTTCAGA GGTGTCTGCATTATTGGGCCGAATCCCTTCTGCTGTGGGCTATCAGCCTACCCTGGCCAC TGACATGGGTACTATGCAGGAAAGAATTACCACTACCAAGAAGGGATCTATCACCTCTGT ACAGGCTATCTATGTGCCTGCTGATGACTTGACTGACCCTGCCCCTGCTACTACGTTTGC CCATTTGGATGCTACCACTGTACTGTCGCGTGCCATTGCTGAGCTGGGCATCTATCCAGC TGTGGATCCTCTAGACTCCACCTCTCGTATCATGGATCCCAACATTGTTGGCAGTGAGCA TTACGATGTTGCCCGTGGGGTGCAAAAGATCCTGCAGGACTACAAATCCCTCCAGGATAT CATTGCCATCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACCGTGTCCCGTGC ACGGAAAATACAGCGTTTCTTGTCTCAGCCATTCCAGGTTGCTGAGGTCTTCACAGGTCA TATGGGGAAGCTGGTACCCCTGAAGGAGACCATCAAAGGATTCCAGCAGATTTTGGCAGG TGAATATGACCATCTCCCAGAACAGGCCTTCTATATGGTGGGACCCATTGAAGAAGCTGT GGCAAAAGCTGATAAGCTGGCTGAAGAGCATTCATCGTGAGGGGTCTTTGTCCTCTGTAC TGTCTCTCTCCTTGCCCCTAACCCAAAAAGCTTCATTTTTCTGTGTAGGCTGCACAAGAG CCTTGATTGAAGATATATTCTTTCTGAACAGTATTTAAGGTTTCCAATAAAATGTACACC CCTCAGAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001686 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001686.3, NP_001677.2 |
RefSeq Size | 1857 bp |
RefSeq ORF | 1590 bp |
Locus ID | 506 |
UniProt ID | P06576 |
Cytogenetics | 12q13.3 |
Domains | ATP-synt_ab, ATP-synt_ab_C, AAA, ATP-synt_ab_N |
Protein Families | Druggable Genome |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the beta subunit of the catalytic core. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201638 | ATP5B (Myc-DDK-tagged)-Human ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), nuclear gene encoding mitochondrial protein |
USD 738.00 |
|
RC201638L1 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 1,038.00 |
|
RC201638L2 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 1,038.00 |
|
RC201638L3 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
USD 1,038.00 |
|
RC201638L4 | Lenti ORF clone of Human ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), nuclear gene encoding mitochondrial protein, mGFP tagged |
USD 1,038.00 |
|
RG201638 | ATP5B (tGFP-tagged) - Human ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), nuclear gene encoding mitochondrial protein |
USD 938.00 |
|
SC127589 | ATP5B (untagged)-Human ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide (ATP5B), nuclear gene encoding mitochondrial protein |
USD 740.00 |
{0} Product Review(s)
Be the first one to submit a review