Caspase 3(CASP3) (NM_032991) Human Untagged Clone

CAT#: SC322483

CASP3 (untagged)-Human caspase 3, apoptosis-related cysteine peptidase (CASP3), transcript variant beta

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Caspase 3(CASP3) (NM_032991) Human Untagged Clone
Symbol CASP3
Synonyms CPP32; CPP32B; SCA-1
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for SC322483 CGGATGGGTGCTATTGTGAGGCGGTTGTGGAAGAGTTTCGTGAGTGCTCGCAGCTCATAC
CTGTGGCTGTGTATCCGTGGCCACAGCTGGTTGGCGTCGCCTTGAAATCCCAGGCCGTGA
GGAGTTAGCGAGCCCTGCTCACACTCGGCGCTCTGGTTTTCGGTGGGTGTGCCCTGCACC
TGCCTCTTCCCCCATTCTCATTAATAAAGGTATCCATGGAGAACACTGAAAACTCAGTGG
ATTCAAAATCCATTAAAAATTTGGAACCAAAGATCATACATGGAAGCGAATCAATGGACT
CTGGAATATCCCTGGACAACAGTTATAAAATGGATTATCCTGAGATGGGTTTATGTATAA
TAATTAATAATAAGAATTTTCATAAAAGCACTGGAATGACATCTCGGTCTGGTACAGATG
TCGATGCAGCAAACCTCAGGGAAACATTCAGAAACTTGAAATATGAAGTCAGGAATAAAA
ATGATCTTACACGTGAAGAAATTGTGGAATTGATGCGTGATGTTTCTAAAGAAGATCACA
GCAAAAGGAGCAGTTTTGTTTGTGTGCTTCTGAGCCATGGTGAAGAAGGAATAATTTTTG
GAACAAATGGACCTGTTGACCTGAAAAAAATAACAAACTTTTTCAGAGGGGATCGTTGTA
GAAGTCTAACTGGAAAACCCAAACTTTTCATTATTCAGGCCTGCCGTGGTACAGAACTGG
ACTGTGGCATTGAGACAGACAGTGGTGTTGATGATGACATGGCGTGTCATAAAATACCAG
TGGAGGCCGACTTCTTGTATGCATACTCCACAGCACCTGGTTATTATTCTTGGCGAAATT
CAAAGGATGGCTCCTGGTTCATCCAGTCGCTTTGTGCCATGCTGAAACAGTATGCCGACA
AGCTTGAATTTATGCACATTCTTACCCGGGTTAACCGAAAGGTGGCAACAGAATTTGAGT
CCTTTTCCTTTGACGCTACTTTTCATGCAAAGAAACAGATTCCATGTATTGTTTCCATGC
TCACAAAAGAACTCTATTTTTATCACTAAAGAAATGGTTGGTTGGTGGTTTTTTTTAGTT
TGTATGCCAAGTGAGAAGATGGTATATTTGGTACTGTATTTCCCTCTCATTTTGACCTAC
TCTCATGCTGCAGAGGGTACTTTAAGACATACTCCTTCCATCAAATAGAACCACTATGAA
GCTACCTCAAACTTCCAGTCAGGTAGTTGCAATTGAATTAAATTAGGAATAAATAAAAAT
GGATACTGGTGCAGTCATTATGAGAGGCAATGATTGTTAATTTACAGCTTTCATGATTAG
CAAGTTACAGTGATGCTGTGCTATGAATTTTCAAGTAATTGTGAAAAAGTTAAACATTGA
AGTAATGAATTTTTATGATATTCCCCCCACTTAAGACTGTGTATTCTAGTTTTGTCAAAC
TGTAGAAATGATGATGTGGAAGAACTTAGGCATCTGTGGGCATGGTCAAAGGCTCAAACC
TTTATTTTAGAATTGATATACACGGATGACTTAACTGCATTTTTAGACCATTTATCTGGG
ATTATGGTTTTGTGATGTTTGTCCTGAACACTTTTGTTGTAAAAAAATAATAATAATGTT
TAATATTGAGAAAGAAACTAATATTTTATGTGAGAGAAAGTGTGAGCAAACTAACTTGAC
TTTTAAGGCTAAAACTTAACATTCATAGAGGGGTGGAGTTTTAACTGTAAGGTGCTACAA
TGCCCCTGGATCTACCAGCATAAATATCTTCTGATTTGTCCCTATGCATATCAGTTGAGC
TTCATATACCAGCAATATATCTGAAGAGCTATTATATAAAAACCCCAAACTGTTGATTAT
TAGCCAGGTAATGTGAATAAATTCTATAGGAACATATGAAAATACAACTTAAATAATAAA
CAGTGGAATATAAGGAAAGCAATAAATGAATGGGCTGAGCTGCCTGTAACTTGAGAGTAG
ATGGTTTGAGCCTGAGCAGAGACATGACTCAGCCTGTTCCATGAAGGCAGAGCCATGGAC
CACGCAGGAAGGGCCTACAGCCCATTTCTCCATACGCACTGGTATGTGTGGATGATGCTG
CCAGGGCGCCATCGCCAAGTAAGAAAGTGAAGCAAATCAGAAACTTGTGAAGTGGAAATG
TTCTAAAGGTGGTGAGGCAATAAAAATCATAGTACTCTTTGTAGCAAAATTCTTAAGTAT
GTTATTTTCTGTTGAAGTTTACAATCAAAGGAAAATAGTAATGTTTTATACTGTTTACTG
AAAGAAAAAGACCTATGAGCACATAGGACTCTAGACGGCATCCAGCCGGAGGCCAGAGCT
GAGCCCTCAGCCCGGGAGGCAGGCTCCAGGCCTCAGCAGGTGCGGAGCCGTCACTGCACC
AAGTCTCACTGGCTGTCAGTATGACATTTCACGGGAGATTTCTTGTTGCTCAAAAAATGA
GCTCGCGTTTGTCAATGACAGTTTCTTTTTTCTTACTAGACCTGTAACTTTTGTAAATAC
ACATAGCATGTAATGGTATCTTAAAGTGTGTTTCTATGTGACAATTTTGTACAAATTTGT
TATTTTCCATTTTTATTTCAAAATATACATTCAAACTTAAAATTAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for SC322483 unedited
CGTACGATAGAACGACTACTATAGGGCGGAGAACGCGGGTGAGGACCGGCCGGGGCAAAA
AAGCACCAGCGTCCGCGGACGCGTGGGCGGATGGGTGCTATTGTGAGGCGGTTGTGGAAG
AGTTTCGTGAGTGCTCGCAGCTCATACCTGTGGCTGTGTATCCGTGGCCACAGCTGGTTG
GCGTCGCCTTGAAATCCCAGGCCGTGAGGAGTTAGCGAGCCCTGCTCACACTCGGCGCTC
TGGTTTTCGGTGGGTGTGCCCTGCACCTGCCTCTTCCCCCATTCTCATTAATAAAGGTAT
CCAGGGAAAACACAAAAAAACACAGGGGATTCAAAATCCATTAAAAATTTGGAACCAAAG
ATCATACATGGAAGCGAATCAATGGACTGTGGAATATCCCTGGACAACAGTTATAAAATG
GATTATCCTGAGATGGGTTTATGTATAATAATTAATAATAAAAATTTTCATAAAAGCACT
GGAATGACATCTCGGGTCTGGGTACAGATGTTCGATGCAGCCAAACCCTCAGGGGAAAAC
ATTCAGAACCTTGAAAATATGAAGTCAGGGAGTAAAAAATGATCTTAACCCGTGAAGAAA
ATTGTGAAATTTGATGCGGTGATGTTTTCTAAAAAAATAATCACAGCAAAAGAGACCAAT
TTTGGTTTGTGTGGCTTCTTGACCCCTGGGGGAAAGAAGGGAATAATTTTTAGAGAAACA
AAAAGGGGACCCTGGATGACCCCGGAAAAAAAATACCCCACTTTTTTCAAAAGGGGGAAC
CGT
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_032991
ORF Size 834 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_032991.2, NP_116786
RefSeq Size 2522
Locus ID 836
Cytogenetics 4q35.1
Domains CASc, ICE_p10, ICE_p20
Protein Families ES Cell Differentiation/IPS, Protease, Druggable Genome
Protein Pathways MAPK signaling pathway, p53 signaling pathway, Apoptosis, Natural killer cell mediated cytotoxicity, Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis (ALS), Huntington's disease, Epithelial cell signaling in Helicobacter pylori infection, Pathways in cancer, Colorectal cancer, Viral myocarditis
Gene Summary This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 6, 7 and 9, and the protein itself is processed by caspases 8, 9 and 10. It is the predominant caspase involved in the cleavage of amyloid-beta 4A precursor protein, which is associated with neuronal death in Alzheimer's disease. Alternative splicing of this gene results in two transcript variants that encode the same protein. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (beta) differs in the 5' UTR, compared to variant alpha.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations