Rad9 (RAD9A) (NM_004584) Human Untagged Clone

SKU
SC321679
RAD9A (untagged)-Human RAD9 homolog A (S. pombe) (RAD9A)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Rad9
Synonyms RAD9
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC321679 representing NM_004584.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGTGCCTGGTCACGGGCGGCAACGTGAAGGTGCTCGGCAAGGCCGTCCACTCCCTGTCCCGCATC
GGGGACGAGCTCTACCTGGAACCCTTGGAGGACGGGCTCTCCCTCCGGACGGTGAACTCCTCCCGCTCT
GCCTATGCCTGCTTTCTCTTTGCCCCGCTCTTCTTCCAGCAATACCAGGCAGCCACCCCTGGTCAGGAC
CTGCTGCGCTGTAAGATCCTGATGAAGTCTTTCCTGTCTGTCTTCCGCTCACTGGCGATGCTGGAGAAG
ACGGTGGAAAAATGCTGCATCTCCCTGAATGGCCGGAGCAGCCGCCTGGTGGTCCAGCTGCATTGCAAG
TTCGGGGTGCGGAAGACTCACAACCTGTCCTTCCAGGACTGTGAGTCCCTGCAGGCCGTCTTCGACCCA
GCCTCGTGCCCCCACATGCTCCGCGCCCCAGCACGGGTTCTGGGGGAGGCTGTTCTGCCCTTCTCTCCT
GCACTGGCTGAAGTGACGCTGGGCATTGGCCGTGGCCGCAGGGTCATCCTGCGCAGCTACCACGAGGAG
GAGGCAGACAGCACTGCCAAAGCCATGGTGACTGAGATGTGCCTTGGAGAGGAGGATTTCCAGCAGCTG
CAGGCCCAGGAAGGGGTGGCCATCACTTTCTGCCTCAAGGAATTCCGGGGGCTCCTGAGCTTTGCAGAG
TCAGCAAACTTGAATCTTAGCATTCATTTTGATGCTCCAGGCAGGCCCGCCATCTTCACCATCAAGGAC
TCTTTGCTGGACGGCCACTTTGTCTTGGCCACACTCTCAGACACCGACTCGCACTCCCAGGACCTGGGC
TCCCCAGAGCGTCACCAGCCAGTGCCTCAGCTCCAGGCTCACAGCACACCCCACCCGGACGACTTTGCC
AATGACGACATTGACTCTTACATGATCGCCATGGAAACCACTATAGGCAATGAGGGCTCGCGGGTGCTG
CCCTCCATTTCCCTTTCACCTGGCCCCCAGCCCCCCAAGAGCCCCGGTCCCCACTCCGAGGAGGAAGAT
GAGGCTGAGCCCAGTACAGTGCCTGGGACTCCCCCACCCAAGAAGTTCCGCTCACTGTTCTTCGGCTCC
ATCCTGGCCCCTGTACGCTCCCCCCAGGGCCCCAGCCCTGTGCTGGCGGAAGACAGTGAGGGTGAAGGC
TGA

Restriction Sites Please inquire
ACCN NM_004584
Insert Size 1176 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004584.2
RefSeq Size 2128 bp
RefSeq ORF 1176 bp
Locus ID 5883
UniProt ID Q99638
Cytogenetics 11q13.2
Domains Rad9
Protein Families Druggable Genome, Stem cell - Pluripotency
MW 42.5 kDa
Summary This gene product is highly similar to Schizosaccharomyces pombe rad9, a cell cycle checkpoint protein required for cell cycle arrest and DNA damage repair. This protein possesses 3' to 5' exonuclease activity, which may contribute to its role in sensing and repairing DNA damage. It forms a checkpoint protein complex with RAD1 and HUS1. This complex is recruited by checkpoint protein RAD17 to the sites of DNA damage, which is thought to be important for triggering the checkpoint-signaling cascade. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (1) represents the predominant transcript, and encodes the longer isoform (1).
Write Your Own Review
You're reviewing:Rad9 (RAD9A) (NM_004584) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204439 RAD9A (Myc-DDK-tagged)-Human RAD9 homolog A (S. pombe) (RAD9A) 10 ug
$457.00
RC204439L1 Lenti ORF clone of Human RAD9 homolog A (S. pombe) (RAD9A), Myc-DDK-tagged 10 ug
$757.00
RC204439L2 Lenti ORF clone of Human RAD9 homolog A (S. pombe) (RAD9A), mGFP tagged 10 ug
$757.00
RC204439L3 Lenti ORF clone of Human RAD9 homolog A (S. pombe) (RAD9A), Myc-DDK-tagged 10 ug
$757.00
RC204439L4 Lenti ORF clone of Human RAD9 homolog A (S. pombe) (RAD9A), mGFP tagged 10 ug
$757.00
RG204439 RAD9A (tGFP-tagged) - Human RAD9 homolog A (S. pombe) (RAD9A) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.