Hsp75(TRAP1) (NM_016292) Human Untagged Clone

CAT#: SC321607

TRAP1 (untagged)-Human TNF receptor-associated protein 1 (TRAP1)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Hsp75(TRAP1) (NM_016292) Human Untagged Clone
Symbol TRAP1
Synonyms HSP 75; HSP75; HSP90L; TRAP-1
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_016292.1 GTACGACATGGCGCGCGAGCTGCGGGCGCTGCTGCTGTGGGGCCGCCGCCTGCGGCCTTT
GCTGCGGGCGCCGGCGCTGGCGGCCGTGCCGGGAGGAAAACCAATTCTGTGTCCTCGGAG
GACCACAGCCCAGTTGGGCCCCAGGCGAAACCCAGCCTGGAGCTTGCAGGCAGGACGACT
GTTCAGCACGCAGACCGCCGAGGACAAGGAGGAACCCCTGCACTCGATTATCAGCAGCAC
AGAGAGCGTGCAGGGTTCCACTTCCAAACATGAGTTCCAGGCCGAGACAAAGAAGCTTTT
GGACATTGTTGCCCGGTCCCTGTACTCAGAAAAAGAGGTGTTTATACGGGAGCTGATCTC
CAATGCCAGCGATGCCTTGGAAAAACTGCGTCACAAACTGGTGTCTGACGGCCAAGCACT
GCCAGAAATGGAGATTCACTTGCAGACCAATGCCGAGAAAGGCACCATCACCATCCAGGA
TACTGGTATCGGGATGACACAGGAAGAGCTGGTGTCCAACCTGGGGACGATTGCCAGATC
GGGGTCAAAGGCCTTCCTGGATGCTCTGCAGAACCAGGCTGAGGCCAGCAGCAAGATCAT
CGGCCAGTTTGGAGTGGGTTTCTACTCAGCTTTCATGGTGGCTGACAGAGTGGAGGTCTA
TTCCCGCTCGGCAGCCCCGGGGAGCCTGGGTTACCAGTGGCTTTCAGATGGTTCTGGAGT
GTTTGAAATCGCCGAAGCTTCGGGAGTTAGAACCGGGACAAAAATCATCATCCACCTGAA
ATCCGACTGCAAGGAGTTTTCCAGCGAGGCCCGGGTGCGAGATGTGGTAACGAAGTACAG
CAACTTCGTCAGCTTCCCCTTGTACTTGAATGGAAGGCGGATGAACACCTTGCAGGCCAT
CTGGATGATGGACCCCAAGGATGTCCGTGAGTGGCAACATGAGGAGTTCTACCGCTACGT
CGCGCAGGCTCACGACAAGCCCCGCTACACCCTGCACTATAAGACGGACGCACCGCTCAA
CATCCGCAGCATCTTCTACGTGCCCGACATGAAACCGTCCATGTTTGATGTGAGCCGGGA
GCTGGGCTCCAGCGTTGCACTGTACAGCCGCAAAGTCCTCATCCAGACCAAGGCCACGGA
CATCCTGCCCAAGTGGCTGCGCTTCATCCGAGGTGTGGTGGACAGTGAGGACATTCCCCT
GAACCTCAGCCGGGAGCTGCTGCAGGAGAGCGCACTCATCAGGAAACTCCGGGACGTTTT
ACAGCAGAGGCTGATCAAATTCTTCATTGACCAGAGTAAAAAAGATGCTGAGAAGTATGC
AAAGTTTTTTGAAGATTACGGCCTGTTCATGCGGGAGGGCATTGTGACCGCCACCGAGCA
GGAGGTCAAGGAGGACATAGCAAAGCTGCTGCGCTACGAGTCCTCGGCGCTGCCCTCCGG
GCAGCTAACCAGCCTCTCAGAATACGCCAGCCGCATGCGGGCCGGCACCCGCAACATCTA
CTACCTGTGCGCCCCCAACCGTCACCTGGCAGAGCACTCACCCTACTATGAGGCCATGAA
GAAGAAAGACACAGAGGTTCTCTTCTGCTTTGAGCAGTTTGATGAGCTCACCCTGCTGCA
CCTTCGTGAGTTTGACAAGAAGAAGCTGATCTCTGTGGAGACGGACATAGTCGTGGATCA
CTACAAGGAGGAGAAGTTTGAGGACAGGTCCCCAGCCGCCGAGTGCCTATCAGAGAAGGA
GACGGAGGAGCTCATGGCCTGGATGAGAAATGTGCTGGGGTCGCGTGTCACCAACGTGAA
GGTGACCCTCCGACTGGACACCCACCCTGCCATGGTCACCGTGCTGGAGATGGGGGCTGC
CCGCCACTTCCTGCGCATGCAGCAGCTGGCCAAGACCCAGGAGGAGCGCGCACAGCTCCT
GCAGCCCACGCTGGAGATCAACCCCAGGCACGCGCTCATCAAGAAGCTGAATCAGCTGCG
CGCAAGCGAGCCTGGCCTGGCTCAGCTGCTGGTGGATCAGATATACGAGAACGCCATGAT
TGCTGCTGGACTTGTTGACGACCCTAGGGCCATGGTGGGCCGCTTGAATGAGCTGCTTGT
CAAGGCCCTGGAGCGACACTGACAGCCAGGGGGCCAGAAGGACTGACACCACAGATGACA
GCCCCACCTCCTTGAGCTTTATTTACCTAAATTTAAAGGTATTTCTTAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_016292.1 unedited
GGCCGTTTGTATACGACTCCTATAGGGCGGCCGGGCAATTCGGCACGAGGGTACGACATG
GCGCGCGAGCTGCGGGCGCTGCTGCTGTGGGGCCGCCGCCTGCGGCCTTTGCTGCGGGCG
CCGGCGCTGGCGGCCGTGCCGGGAGGAAAACCAATTCTGTGTCCTCGGAGGACCACAGCC
CAGTTGGGCCCCAGGCGAAACCCAGCCTGGAGCTTGCAGGCAGGACGACTGTTCAGCACG
CAGACCGCCGAGGACAAGGAGGAACCCCTGCACTCGATTATCAGCAGCACAGAGAGCGTG
CAGGGTTCCACTTCCAAACATGAGTTCCAGGCTGAGACAAAGAAGCTTTTGGACATTGTT
GCCCGGTCCCTGTACTCAGAAAAAGAGGTGTTTATACGGGAGCTGATCTCCAATGCCAGC
GATGCCTTGGAAAAACTGCGTCACAAACTGGTGTCTGACGGCCAAGCACTGCCAGAAATG
GAGATTCACTTGCAGACCAATGCCGAGAAAGGCACCATCACCATCCAGGATACTGGTATC
GGGATGACACAGGAAGAGCTGGTGTCCAACCTGGGGACGATTGCCAGATCGGGGTCAAAG
GCCTTCCTGGATGCTCTGCAGAACCAGGCTGAGCCAGCAGCAAGATCATCGGCCAGTTTG
GAGTGGGTTTCTACTCAGCTTTCATGGTGGCTGACAGAGTGGAGGTCTATTCCCGCTCGG
CAGCCCCGGGGAGCCTGGTTACCAGTGGCTTTCAGATGGGTTCTGGAGTGTTTGAAATCG
CCGAAGCTTCGGAGTTAGACCCGGGACAAAAATCATCATCCACCTGAAATCCGACTGCAG
AGTTTCAGCGAGCCGGGTGGCAGATGTGTAACGAGTACAGCAACTTCGTCAGCTCCTTGT
ACTGGATTGAATGCGATGAACACTGGCAGGCACTTGGATGATGGAACCCCAG
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_016292
ORF Size 2115 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_016292.1, NP_057376
RefSeq Size 2225
Locus ID 10131
Cytogenetics 16p13.3
Domains HSP90, HATPase_c
Protein Families Druggable Genome
Gene Summary This gene encodes a mitochondrial chaperone protein that is member of the heat shock protein 90 (HSP90) family. The encoded protein has ATPase activity and interacts with tumor necrosis factor type I. This protein may function in regulating cellular stress responses. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013].
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.