RHOA (NM_001664) Human Untagged Clone

CAT#: SC321534

RHOA (untagged)-Human ras homolog gene family, member A (RHOA)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name RHOA (NM_001664) Human Untagged Clone
Symbol RHOA
Synonyms ARH12; ARHA; RHO12; RHOH12
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001664.2 GTTCTCTCGTTAGTCCACGGTCTGGTCTTCAGCTACCCGCCTTCGTCTCCGAGTTTGCGA
CTCGCGGACCGGCGTCCCCGGCGCGAAGAGGCTGGACTCGGATTCGTTGCCTGAGCAATG
GCTGCCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTG
CTCATAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAGAAC
TATGTGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAATTGGCTTTGTGGGACACAGCT
GGGCAGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATACCGATGTTATACTG
ATGTGTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAGTGGACCCCA
GAAGTCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAATAAGAAGGATCTT
CGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAACCT
GAAGAAGGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCA
AAGACCAAAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAAGCT
AGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCTTGCTGCAAGCACAGCC
CTTATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTT
TCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCTTGCTACCAGTATTTA
GAAGCCAACTATGATTATTAACGATGTCCAACCCGTCTGGCCCACCAGGGTCCTTTTGAC
ACTGCTCTAACAGCCCTCCTCTGCACTCCCACCTGACACACCAGGCGCTAATTCAAGGAA
TTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAACAGTTGGTAACTTTTGTGAATTAGG
CTGTAACTACTTTATAACTAACATGTCCTGCCTATTATCTGTCAGCTGCAAGGTACTCTG
GTGAGTCACCACTTCAGGGCTTTACTCCGTAACAGATTTTGTTGGCATAGCTCTGGGGTG
GGCAGTTTTTTGAAAATGGGCTCAACCAGAAAAGCCCAAGTTCATGCAGCTGTGGCAGAG
TTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTA
ATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAA
TTGGATTTCCTAATACTGTCATCCTCAAAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGT
GTATTTGGAAATAAAGTCAGATGGAAAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001664.2 unedited
GGCAGTTGTATACGACTCCTATAGGGCGGCCGGGAATTCGGCCATTACGGCCGGGGGTTC
TCTCGTTAGTCCACGGTCTGGTCTTCAGCTACCCGCCTTCGTCTCCGAGTTTGCGACTCG
CGGACCGGCGTCCCCGGCGCGAAGAGGCTGGACTCGGATTCGTTGCCTGAGCAATGGCTG
CCATCCGGAAGAAACTGGTGATTGTTGGTGATGGAGCCTGTGGAAAGACATGCTTGCTCA
TAGTCTTCAGCAAGGACCAGTTCCCAGAGGTGTATGTGCCCACAGTGTTTGAGAACTATG
TGGCAGATATCGAGGTGGATGGAAAGCAGGTAGAATTGGCTTTGTGGGACACAGCTGGGC
AGGAAGATTATGATCGCCTGAGGCCCCTCTCCTACCCAGATACCGATGTTATACTGATGT
GTTTTTCCATCGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAGTGGACCCCAGAAG
TCAAGCATTTCTGTCCCAACGTGCCCATCATCCTGGTTGGGAATAAGAAGGATCTTCGGA
ATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTGAAACCTGAAG
AAGCAGAGATATGGCAAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAGAC
CAAAGATGGAGTGAGAGAGGTTTTTGAAATGGCTACGAGAGCTGCTCTGCAAGCTAGACG
TGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCTTGCTGCAAGCACAGCCCTTAT
GCGGTTAAATTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCCTTTTCATT
TATTCTATATTTACCTAGGATTACAATCAGAGTCATCTTGCTACCAGTTATTTAGAAGCC
ACTATGATTATTACGATGTTCAACCCGTTCTTGGCCCCACAGGTCCTTTTGGACACCTGC
TTCTATA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_001664
ORF Size 582 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001664.2, NP_001655
RefSeq Size 1926
RefSeq ORF 582
Locus ID 387
Cytogenetics 3p21.31
Domains ras, RAS, RHO, RAB
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway, Vascular smooth muscle contraction, Wnt signaling pathway, TGF-beta signaling pathway, Axon guidance, Focal adhesion, Adherens junction, Tight junction, T cell receptor signaling pathway, Leukocyte transendothelial migration, Neurotrophin signaling pathway, Regulation of actin cytoskeleton, Pathogenic Escherichia coli infection, Pathways in cancer
Gene Summary This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. Overexpression of this gene is associated with tumor cell proliferation and metastasis. Multiple alternatively spliced variants have been identified. [provided by RefSeq, Sep 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations