CPT2 (NM_000098) Human Untagged Clone

CAT#: SC321345

CPT2 (untagged)-Human carnitine palmitoyltransferase 2 (CPT2), nuclear gene encoding mitochondrial protein

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CPT2 (NM_000098) Human Untagged Clone
Symbol CPT2
Synonyms CPT1; CPTASE; IIAE4
Vector pCMV6-AC
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000098.1 GGGCGGAGAAGTGCCTCAGGAGTCCTGACGCAGTGTCTTGGGCGCTAACGGCGGCGGCGG
CCTTGTGTTTAGACTCCAGAACTCCCCACTTGCCGCGTTCTCGCCGCCGCAGGCTCCCGG
GACGATGGTGCCCCGCCTGCTGCTGCGCGCCTGGCCCCGGGGCCCCGCGGTTGGTCCGGG
AGCCCCCAGTCGGCCCCTCAGCGCCGGCTCCGGGCCCGGCCAGTACCTGCAGCGCAGCAT
CGTGCCCACCATGCACTACCAGGACAGCCTGCCCAGGCTGCCTATTCCCAAACTTGAAGA
CACCATTAGGAGATACCTCAGTGCACAGAAGCCTCTCTTGAATGATGGCCAGTTCAGGAA
AACAGAACAATTTTGCAAGAGTTTTGAAAATGGGATTGGAAAAGAACTGCATGAGCAGCT
GGTTGCTCTGGACAAACAGAATAAACATACAAGCTACATTTTGGGACCCTGGTTTGATAT
GTACCTATCTGCTCGAGACTCCGTTGTTCTGAACTTTAATCCATTTATGGCTTTCAATCC
TGACCCAAAATCTGAGTATAATGACCAGCTCACCCGGGCAACCAACATGACTGTTTCTGC
CATCCGGTTTCTGAAGACACTCCGGGCTGGCCTTCTGGAGCCAGAAGTGTTCCACTTGAA
CCCTGCAAAAAGTGACACTATCACCTTCAAGAGACTCATACGCTTTGTGCCTTCCTCTCT
GTCCTGGTATGGGGCCTACCTGGTCAATGCGTATCCCCTGGATATGTCCCAGTATTTTCG
GCTTTTCAACTCAACTCGTTTACCCAAACCCAGTCGGGATGAACTCTTCACTGATGACAA
GGCCAGACACCTCCTGGTCCTAAGGAAAGGAAATTTTTATATCTTTGATGTCCTGGATCA
AGATGGGAACATTGTGAGCCCCTCGGAAATCCAGGCACATCTGAAGTACATTCTCTCAGA
CAGCAGCCCCGCCCCCGAGTTTCCCCTGGCATACCTGACCAGTGAGAACCGAGACATCTG
GGCAGAGCTCAGGCAGAAGCTGATGAGTAGTGGCAATGAGGAGAGCCTGAGGAAAGTGGA
CTCGGCAGTGTTCTGTCTCTGCCTAGATGACTTCCCCATTAAGGACCTTGTCCACTTGTC
CCACAATATGCTGCATGGGGATGGCACAAACCGCTGGTTTGATAAATCCTTTAACCTCAT
TATCGCCAAGGATGGCTCTACTGCCATCCACTTTGAGCACTCTTGGGGTGATGGTGTGGC
AGTGCTCAGATTTTTTAATGAAGTATTTAAAGACAGCACTCAGACCCCTGCCGTCACTCC
ACAGAGCCAGCCAGCTACCACTGACTCTACTGTCACGGTGCAGAAACTCAACTTCGAGCT
GACTGATGCCTTAAAGACTGGCATCACAGCTGCTAAGGAAAAGTTTGATGCCACCATGAA
AACCCTCACTATTGACTGCGTCCAGTTTCAGAGAGGAGGCAAAGAATTCCTGAAGAAGCA
AAAGCTGAGCCCTGACGCAGTTGCCCAGCTGGCATTCCAGATGGCCTTCCTGCGGCAGTA
CGGGCAGACAGTGGCCACCTACGAGTCCTGTAGCACTGCCGCATTCAAGCACGGCCGCAC
TGAGACCATCCGCCCGGCCTCCGTCTATACAAAGAGGTGCTCTGAGGCCTTTGTCAGGGA
GCCCTCCAGGCACAGTGCTGGTGAGCTTCAGCAGATGATGGTTGAGTGCTCCAAGTACCA
TGGCCAGCTGACCAAAGAAGCAGCAATGGGCCAGGGCTTTGACCGACACTTGTTTGCTCT
GCGGCATCTGGCAGCAGCCAAAGGGATCATCTTGCCTGAGCTCTACCTGGACCCTGCATA
CGGGCAGATAAACCACAATGTCCTGTCCACGAGCACACTGAGCAGCCCAGCAGTGAACCT
TGGGGGCTTTGCCCCTGTGGTCTCTGATGGCTTTGGTGTTGGGTATGCTGTTCATGACAA
CTGGATAGGCTGCAATGTCTCTTCCTACCCAGGCCGCAATGCCCGGGAGTTTCTCCAATG
TGTGGAGAAGGCCTTAGAAGACGTGTTTGATGCCTTAGAAGGCAAATCCATCAAAAGTTA
ACTTCTGGGCAGATGAAAAGCTACCATCACTTCCTCATCATGAAAACTGGGAGGCCGGGC
ATGGTGGCTCATGCCTGTAATCCCAGCATTTTGAGAGGCTGAGGCGGGTGGATCACTTGA
GGTCAGGAGTTTGAGACCAACCTGGCCAACATGGTGAAACCTTGTCTCTACTAAAAATAC
AAAAATTAGCTGGGTGTGGTGGCATGTGCCTATAATCCCAGCTACTTGGGAGGTTGAAGC
AGAATTGCTTGAACCCAGGAGGTGGAGGTTGCAGTGAGCTGAGATCACACCACTGCACTC
CGGCCTGGGCGACAGAGCGAGACTGTCTCAAAAAAACAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000098.1 unedited
CACCATTGTATACGACTCCTATAGGGCGGCCGGGCATTCGTCGACTGGATCCGGTACCGA
GGAGATCTGCCGCCGCGATCGCGGCGCGCCAGATCTCAAGCTTAACTAGTTAGCGGACCG
ACGCGTTAAGCGGCCGCGAATTCAGATCCACAAGTTTGTACAAAAAAGCAGGCTTGTAAA
ACGACGGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCGAATTCGGCAC
GAGGGGGCGGAGAAGTGCCTCAGGAGTCCTGACGCAGTGTCTTGGGCGCTAACGGCGGCG
GCGGCCTTGTGTTTAGACTCCAGAACTCCCCACTTGCCGCGTTCTCGCCGCCGCAGGCTC
CCGGGACGATGGTGCCCCGCCTGCTGCTGCGCGCCTGGCCCCGGGGCCCCGCGGTTGGTC
CGGGAGCCCCCAGTCGGCCCCTCAGCGCCGGCTCCGGGCCCGGCCAGTACCTGCAGCGCA
GCATCGTGCCCACCATGCACTACCAGGACAGCCTGCCCAGGCTGCCTATTCCCAAACTTG
AAGACACCATTAGGAGATACCTCAGTGCACAGAAGCCTCTCTTGAATGATGGCCAGTTCA
GGAAAACAGAACAATTTTGCAAGAGTTTTGAAAATGGGATTGGAAAAGAACTGCATGAGC
AGCTGGTTGCTCTGGACAAACAGAATAAACATACAAGCTACATTTTGGGACCCTGGTTTG
ATATGTACCTATCTGCTCGAGACTCCGTTGTTCTGAACTTTAATCCATTTATGGCTTTCA
ATCCTGACCCAAAATCTGAGTATAATGACCAGCTCACCCGGGCAACCAACATGACTGTTT
CTGCCATCGTTTCTGAAGACCCTCCGGGCTGCCTCTGGAGCCAGAGTGTCCACTTGAACC
CTGCAAAAGTGACACTATCACCTCAAGAAACCTCATACGCTTTGTGCCTCCTCTCTGTCC
TGGGATT
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_000098
ORF Size 1977 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000098.1, NP_000089
RefSeq Size 3090
RefSeq ORF 1977
Locus ID 1376
Cytogenetics 1p32.3
Domains Carn_acyltransf
Protein Families Druggable Genome
Protein Pathways Fatty acid metabolism, PPAR signaling pathway
Gene Summary The protein encoded by this gene is a nuclear protein which is transported to the mitochondrial inner membrane. Together with carnitine palmitoyltransferase I, the encoded protein oxidizes long-chain fatty acids in the mitochondria. Defects in this gene are associated with mitochondrial long-chain fatty-acid (LCFA) oxidation disorders. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.