SCAMP2 (NM_005697) Human Untagged Clone

CAT#: SC321330

SCAMP2 (untagged)-Human secretory carrier membrane protein 2 (SCAMP2)


  "NM_005697" in other vectors (6)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
SCAMP2 mouse monoclonal antibody, clone OTI3C2 (formerly 3C2)
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "SCAMP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SCAMP2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_005697.3 CACGAAGCGCCGCTGGGTCTGGGTGCCCGGAGGCAGCAGCGTTCGCGGAGTTCGCCCGCT
GGCCCCCGATCACCATGTCGGCTTTCGACACCAACCCCTTCGCGGACCCAGTGGATGTAA
ACCCCTTCCAGGATCCCTCTGTGACCCAGCTGACCAACGCCCCGCAGGGCGGCCTGGCGG
AATTCAACCCCTTCTCAGAGACAAATGCAGCGACAACAGTTCCTGTCACCCAACTCCCTG
GGTCCTCACAGCCAGCGGTTCTCCAGCCATCAGTGGAACCAACCCAGCCGACCCCCCAGG
CCGTGGTGTCTGCAGCCCAGGCAGGCCTGCTCCGGCAGCAGGAAGAACTGGACAGGAAAG
CTGCCGAGCTGGAACGCAAGGAGCGGGAGCTGCAGAACACTGTAGCCAACTTGCATGTGA
GACAGAACAACTGGCCCCCTCTGCCCTCGTGGTGCCCTGTGAAGCCCTGCTTCTATCAGG
ATTTCTCCACAGAGATCCCTGCCGACTACCAGCGGATATGCAAGATGCTCTACTATCTGT
GGATGTTGCATTCAGTGACTCTGTTTCTGAACCTGCTTGCCTGCCTGGCCTGGTTCTCGG
GCAACAGCTCCAAGGGAGTGGACTTTGGCCTCTCCATCCTGTGGTTTCTGATCTTCACTC
CCTGTGCCTTCCTTTGTTGGTACCGACCCATCTATAAGGCCTTTAGGTCCGACAACTCTT
TCAGCTTCTTTGTGTTCTTCTTTGTATTTTTTTGTCAAATAGGGATCTACATCATCCAGT
TGGTTGGCATCCCTGGCCTGGGGGACAGCGGTTGGATTGCAGCCCTGTCTACACTGGATA
ATCATTCCCTGGCCATATCAGTCATCATGATGGTGGTGGCTGGCTTCTTCACCCTCTGTG
CCGTGCTCTCAGTCTTCCTCCTGCAGCGGGTGCACTCCCTCTACCGACGGACAGGGGCCA
GCTTCCAGCAGGCCCAGGAGGAGTTTTCCCAGGGCATCTTCAGCAGCAGAACCTTCCACA
GAGCTGCTTCATCTGCTGCCCAAGGAGCCTTCCAGGGGAATTAGTCCTCCTCTCTTCTCT
CCCCCTCAGCCTTTCTCTCGCCTGCCTTCTGAGCTGCACTTTCCGTGGGTGCCTTATGTG
GTGGTGGTTGTGCCCAGCACAGACCTGGCAGGGTTCTTGCCGTGGCTCTTCCTCCTCCCT
CAGCGACCAGCTCTCCCTGGAACGGGAGGGACAGGGAATTTTTTCCCCCTCTATGTACAA
AAAAAAACAAAGCTCTCTTTCCTTCTCTGGTAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_005697
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005697.3, NP_005688.2
RefSeq Size 1313 bp
RefSeq ORF 990 bp
Locus ID 10066
UniProt ID O15127
Cytogenetics 15q24.1
Domains SCAMP
Protein Families Transmembrane
Gene Summary This gene product belongs to the SCAMP family of proteins which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that the SCAMPs may function at the same site during vesicular transport rather than in separate pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Transcript Variant: This variant (2) lacks a exon in the central coding region compared to variant 1. The encoded isoform (2) is sorter than isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.