HMGB2 (NM_002129) Human Untagged Clone
CAT#: SC321305
HMGB2 (untagged)-Human high mobility group box 2 (HMGB2), transcript variant 1
"NM_002129" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HMGB2 |
Synonyms | HMG2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002129.2
CTCTGCGGGACTCTGAGGAAAAGCTCGCACCAGGTGGACGCGGATCTGTCAACATGGGTA
AAGGAGACCCCAACAAGCCGCGGGGCAAAATGTCCTCGTACGCCTTCTTCGTGCAGACCT GCCGGGAAGAGCACAAGAAGAAACACCCGGACTCTTCCGTCAATTTCGCGGAATTCTCCA AGAAGTGTTCGGAGAGATGGAAGACCATGTCTGCAAAGGAGAAGTCGAAGTTTGAAGATA TGGCAAAAAGTGACAAAGCTCGCTATGACAGGGAGATGAAAAATTACGTTCCTCCCAAAG GTGATAAGAAGGGGAAGAAAAAGGACCCCAATGCTCCTAAAAGGCCACCATCTGCCTTCT TCCTGTTTTGCTCTGAACATCGCCCAAAGATCAAAAGTGAACACCCTGGCCTATCCATTG GGGATACTGCAAAGAAATTGGGTGAAATGTGGTCTGAGCAGTCAGCCAAAGATAAACAAC CATATGAACAGAAAGCAGCTAAGCTAAAGGAGAAATATGAAAAGGATATTGCTGCATATC GTGCCAAGGGCAAAAGTGAAGCAGGAAAGAAGGGCCCTGGCAGGCCAACAGGCTCAAAGA AGAAGAACGAACCAGAAGATGAGGAGGAGGAGGAGGAAGAAGAAGATGAAGATGAGGAGG AAGAGGATGAAGATGAAGAATAAATGGCTATCCTTTAATGATGCGTGTGGAATGTGTGTG TGTGCTCAGGCAATTATTTTGCTAAGAATGTGAATTCAAGTGCAGCTCAATACTAGCTTC AGTATAAAAACTGTACAGATTTTTGTATAGCTGATAAGATTCTCTGTAGAGAAAATACTT TTAAAAAATGCAGGTTGTAGCTTTTTGATGGGCTACTCATACAGTTAGATTTTACAGCTT CTGATGTTGAATGTTCCTAAATATTTAATGGTTTTTTTAATTTCTTGTGTATGGTAGCAC AGCAAACTTGTAGGAATTAGTATCAATAGTAAATTTTGGGTTTTTTAGGATGTTGCATTT CGTTTTTTTAAAAAAAATTTTGTAATAAAATTATGTATATTAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002129 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002129.2, NP_002120.1 |
RefSeq Size | 1277 bp |
RefSeq ORF | 630 bp |
Locus ID | 3148 |
UniProt ID | P26583 |
Cytogenetics | 4q34.1 |
Domains | HMG |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene encodes a member of the non-histone chromosomal high mobility group protein family. The proteins of this family are chromatin-associated and ubiquitously distributed in the nucleus of higher eukaryotic cells. In vitro studies have demonstrated that this protein is able to efficiently bend DNA and form DNA circles. These studies suggest a role in facilitating cooperative interactions between cis-acting proteins by promoting DNA flexibility. This protein was also reported to be involved in the final ligation step in DNA end-joining processes of DNA double-strand breaks repair and V(D)J recombination. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200750 | HMGB2 (Myc-DDK-tagged)-Human high mobility group box 2 (HMGB2), transcript variant 1 |
USD 300.00 |
|
RC200750L1 | Lenti ORF clone of Human high mobility group box 2 (HMGB2), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC200750L2 | Lenti ORF clone of Human high mobility group box 2 (HMGB2), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RC200750L3 | Lenti ORF clone of Human high mobility group box 2 (HMGB2), transcript variant 1, Myc-DDK-tagged |
USD 600.00 |
|
RC200750L4 | Lenti ORF clone of Human high mobility group box 2 (HMGB2), transcript variant 1, mGFP tagged |
USD 600.00 |
|
RG200750 | HMGB2 (tGFP-tagged) - Human high mobility group box 2 (HMGB2), transcript variant 1 |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review