AK2 (NM_001625) Human Untagged Clone

SKU
SC321133
AK2 (untagged)-Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol AK2
Synonyms ADK2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001625.2 GTGGCAGTGAGAGACTTCGGCGGACATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTA
TCCTAAAGGCATCCGGGCCGTGCTGCTGGGGCCTCCCGGGGCCGGTAAAGGGACCCAGGC
ACCCAGATTGGCTGAAAACTTCTGTGTCTGCCATTTAGCTACTGGGGACATGCTGAGGGC
CATGGTGGCTTCTGGCTCAGAGCTAGGAAAAAAGCTGAAGGCAACTATGGATGCTGGGAA
ACTGGTGAGTGATGAAATGGTAGTGGAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTG
CAAAAATGGTTTTCTTCTGGATGGCTTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGA
TGACCTCATGGAGAAGAGGAAAGAGAAGCTTGATTCTGTGATTGAATTCAGCATCCCAGA
CTCTCTGCTGATCCGAAGAATCACAGGAAGGCTGATTCACCCCAAGAGTGGCCGTTCCTA
CCACGAGGAGTTCAACCCTCCAAAAGAGCCCATGAAAGATGACATCACCGGGGAACCCTT
GATCCGTCGATCAGATGATAATGAAAAGGCCTTGAAAATCCGCCTGCAAGCCTACCACAC
TCAAACCACCCCACTCATAGAGTACTACAGGAAACGGGGGATCCACTCCGCCATCGATGC
ATCCCAGACCCCCGATGTCGTGTTCGCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATG
TAAAGACTTGGTTATGTTTATCTAATGTTGGGTCCAAGAAGGAATTTCTTTCCATCCCTG
TGAGGCAATGGGTGGGAATGATAGGACAGGCAAAGAGAAGCTTCCTCAGGCTAGCAAAAA
TATCATTTGATGTATTGATTAAAAAAGCACTTGCTTGATGTAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_001625
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001625.2, NP_001616.1
RefSeq Size 961 bp
RefSeq ORF 720 bp
Locus ID 204
UniProt ID P54819
Cytogenetics 1p35.1
Domains ADK, ADK_lid
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
Summary Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1), also known as AK2A, encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:AK2 (NM_001625) Human Untagged Clone
Your Rating
SKU Description Size Price
RC209974 AK2 (Myc-DDK-tagged)-Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$300.00
RC209974L3 Lenti ORF clone of Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC209974L4 Lenti ORF clone of Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged 10 ug
$600.00
RG209974 AK2 (tGFP-tagged) - Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00
SC111586 AK2 (untagged)-Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1 10 ug
$300.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.