CYLD (NM_001042355) Human Untagged Clone

CAT#: SC320389

CYLD (untagged)-Human cylindromatosis (turban tumor syndrome) (CYLD), transcript variant 2

  View "NM_001042355" in other vectors (11)

USD 740.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name CYLD (NM_001042355) Human Untagged Clone
Symbol CYLD
Synonyms BRSS; CDMT; CYLD1; CYLDI; EAC; MFT; MFT1; SBS; TEM; USPL2
Vector pCMV6-AC
Sequence Data
>OriGene sequence for NM_001042355 edited
GTGTGGGGAGCCGGGGCCGGCCCGGGACGCGGGCTGGGGAGCCGGGGCG:AGGGGCGACG
CCCCGCCGCCCGAGTTTCCCCCTTTCTAGGGTGAGGATGGTTCTACACAGCCACCCGGAG
TTCCTTAGTTGAAAGGTGCGCCCTGCTGTGACAGCATGGACACCACGTTGCTGAAAACAT
GCTTTGGGACTGCCACTGAATTTATCTTTTGCGGTTTTATGACAAAGTTATTAGTAGTTT
CCCTTTTTTGAATTAGTATTTTGAAGTTAATATCACAATGAGTTCAGGCTTATGGAGCCA
AGAAAAAGTCACTTCACCCTACTGGGAAGAGCGGATTTTTTACTTGCTTCTTCAAGAATG
CAGCGTTACAGACAAACAAACACAAAAGCTCCTTAAAGTACCGAAGGGAAGTATAGGACA
GTATATTCAAGATCGTTCTGTGGGGCATTCAAGGATTCCTTCTGCAAAAGGCAAGAAAAA
TCAGATTGGATTAAAAATTCTAGAGCAACCTCATGCAGTTCTCTTTGTTGATGAAAAGGA
TGTTGTAGAGATAAATGAAAAGTTCACAGAGTTACTTTTGGCAATTACCAATTGTGAGGA
GAGGTTCAGCCTGTTTAAAAACAGAAACAGACTAAGTAAAGGCCTCCAAATAGACGTGGG
CTGTCCTGTGAAAGTACAGCTGAGATCTGGGGAAGAAAAATTTCCTGGAGTTGTACGCTT
CAGAGGACCCCTGTTAGCAGAGAGGACAGTCTCCGGAATATTCTTTGGAGTTGAATTGCT
GGAAGAAGGTCGTGGTCAAGGTTTCACTGACGGGGTGTACCAAGGGAAACAGCTTTTTCA
GTGTGATGAAGATTGTGGCGTGTTTGTTGCATTGGACAAGCTAGAACTCATAGAAGATGA
TGACACTGCATTGGAAAGTGATTACGCAGGTCCTGGGGACACAATGCAGGTCGAACTTCC
TCCTTTGGAAATAAACTCCAGAGTTTCTTTGAAGGTTGGAGAAACAATAGAATCTGGAAC
AGTTATATTCTGTGATGTTTTGCCAGGAAAAGAAAGCTTAGGATATTTTGTTGGTGTGGA
CATGGATAACCCTATTGGCAACTGGGATGGAAGATTTGATGGAGTGCAGCTTTGTAGTTT
TGCGTGTGTTGAAAGTACAATTCTATTGCACATCAATGATATCATCCCAGAGAGTGTGAC
GCAGGAAAGGAGGCCTCCCAAACTTGCCTTTATGTCAAGAGGTGTTGGGGACAAAGGTTC
ATCCAGTCATAATAAACCAAAGGCTACAGGATCTACCTCAGACCCTGGAAATAGAAACAG
ATCTGAATTATTTTATACCTTAAATGGGTCTTCTGTTGACTCACAACCACAATCCAAATC
AAAAAATACATGGTACATTGATGAAGTTGCAGAAGACCCTGCAAAATCTCTTACAGAGAT
ATCTACAGACTTTGACCGTTCTTCACCACCACTCCAGCCTCCTCCTGTGAACTCACTGAC
CACCGAGAACAGATTCCACTCTTTACCATTCAGTCTCACCAAGATGCCCAATACCAATGG
AAGTATTGGCCACAGTCCACTTTCTCTGTCAGCCCAGTCTGTAATGGAAGAGCTAAACAC
TGCACCCGTCCAAGAGAGTCCACCCTTGGCCATGCCTCCTGGGAACTCACATGGTCTAGA
AGTGGGCTCATTGGCTGAAGTTAAGGAGAACCCTCCTTTCTATGGGGTAATCCGTTGGAT
CGGTCAGCCACCAGGACTGAATGAAGTGCTCGCTGGACTGGAACTGGAAGATGAGTGTGC
AGGCTGTACGGATGGAACCTTCAGAGGCACTCGGTATTTCACCTGTGCCCTGAAGAAGGC
GCTGTTTGTGAAACTGAAGAGCTGCAGGCCTGACTCTAGGTTTGCATCATTGCAGCCGGT
TTCCAATCAGATTGAGCGCTGTAACTCTTTAGCATTTGGAGGCTACTTAAGTGAAGTAGT
AGAAGAAAATACTCCACCAAAAATGGAAAAAGAAGGCTTGGAGATAATGATTGGGAAGAA
GAAAGGCATCCAGGGTCATTACAATTCTTGTTACTTAGACTCAACCTTATTCTGCTTATT
TGCTTTTAGTTCTGTTCTGGACACTGTGTTACTTAGACCCAAAGAAAAGAACGATGTAGA
ATATTATAGTGAAACCCAAGAGCTACTGAGGACAGAAATTGTTAATCCTCTGAGAATATA
TGGATATGTGTGTGCCACAAAAATTATGAAACTGAGGAAAATACTTGAAAAGGTGGAGGC
TGCATCAGGATTTACCTCTGAAGAAAAAGATCCTGAGGAATTCTTGAATATTCTGTTTCA
TCATATTTTAAGGGTAGAACCTTTGCTAAAAATAAGATCAGCAGGTCAAAAGGTACAAGA
TTGTTACTTCTATCAAATTTTTATGGAAAAAAATGAGAAAGTTGGCGTTCCCACAATTCA
GCAGTTGTTAGAATGGTCTTTTATCAACAGTAACCTGAAATTTGCAGAGGCACCATCATG
TCTGATTATTCAGATGCCTCGATTTGGAAAAGACTTTAAACTATTTAAAAAAATTTTTCC
TTCTCTGGAATTAAATATAACAGATTTACTTGAAGACACTCCCAGACAGTGCCGGATATG
TGGAGGGCTTGCAATGTATGAGTGTAGAGAATGCTACGACGATCCGGACATCTCAGCTGG
AAAAATCAAGCAGTTTTGTAAAACCTGCAACACTCAAGTCCACCTTCATCCGAAGAGGCT
GAATCATAAATATAACCCAGTGTCACTTCCCAAAGACTTACCCGACTGGGACTGGAGACA
CGGCTGCATCCCTTGCCAGAATATGGAGTTATTTGCTGTTCTCTGCATAGAAACAAGCCA
CTATGTTGCTTTTGTGAAGTATGGGAAGGACGATTCTGCCTGGCTCTTCTTTGACAGCAT
GGCCGATCGGGATGGTGGTCAGAATGGCTTCAACATTCCTCAAGTCACCCCATGCCCAGA
AGTAGGAGAGTACTTGAAGATGTCTCTGGAAGACCTGCATTCCTTGGACTCCAGGAGAAT
CCAAGGCTGTGCACGAAGACTGCTTTGTGATGCATATATGTGCATGTACCAGAGTCCAAC
AATGAGTTTGTACAAATAACTGGGGTCATCGGGAAAGGCAAAGAAACTGAAGGCAGAGTC
CTAACGTTGCATCTTATTCGAGCTGGCAGTTCTGTTCACGTCCATTGCCGGCAATGGATG
TCTTTGTGGTGATGATCCTTCAGAAAAGGATGCCTCTGTTTAAAAACAAATTGCTTTTGT
GTCCCTGAAGTATTTAATAAGAAGCATTTTGCACTCTAGAAAGTATGTTTGTGTTGGTTT
TTTAAGAAGTCTAAATGAAGTTATTAATACCTGAAGCTTTAAGTTAAGTGCATTGATCAT
ATGATATTTTTGGAAGCATACAATTTTAATTGTGGAAGTTTAAAGCCTCTTTTAGTCCCT
TGAGAATGTAAATAAATGTGTCTTCTTTATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
A
>OriGene 5' read for NM_001042355.1 unedited
GGACACTTTGCGCTATGGTGGCTACTACTATCCGGCGGCCGGGAATTCGTCGACTGGATC
CGGTACCGAGGAGATCTGCCGCCGCGATCGCGGCGCGCCAGATCTCAAGCTTAACTAGTT
AGCGGACCGACGCGTTAAGCGGCCGCGAATTCAGATCCACAAGTTTGTACAAAAAAGCAG
GCTTGTAAAACGACGGCCAGTAACTATAACGGTCCTAAGGTAGCGAGGCCTGGGTGGCGA
ATTCGGCACGAGGGTGTGGGGAGCCGGGGCCGGCCCGGGACGCGGGCTGGGGAGCCGGGG
CGAGGGGCGACGCCCCGCCGCCCGAGTTTCCCTCTTTCTAGGGTGAGGATGGTTCTACAC
AGCCACCCGGAGTTCCTTAGTTGAAAGGTGCGCCCTGCTGTGACAGCATGGACACCACGT
TGCTGAAAACATGCTTTGGGACTGCCACTGAATTTATCTTTTGCGGTTTTATGACAAAGT
TATTAGTAGTTTCCCTTTTTTGAATTAGTATTTTGAAGTTAATATCACAATGAGTTCAGG
CTTATGGAGCCAAGAAAAAGTCACTTCACCCTACTGGGAAGAGCGGATTTTTTACTTGCT
TCTTCAAGAATGCAGCGTTACAGACAAACAAACACAAAAGCTCCTTAAAGTACCGAAAGG
GAAGTATAGGACAGTATATTCAAGATCGTTCTGTGGGGCATTCAAGGATTCCTTCTGCAA
AAGGCAAGAAAAATCAGATTGGATTAAAAATTCTAGAGCAACCTCATGCAGTTCTCTTTG
TTGATGAAAAGGATGTTGTAGAGATAAATGAAAAGTTCACAGAGTTACTTTTGGCAATTA
CCAAATTGTGGAGGAGGAGGTTCAGCCTGTTTAAAAACAGAAACAGACTAAGTAAGGCCT
CCAATAGACGTGGGCTGTCCTGGTGAAGTACAGCTGGAGATCTGGGGAAGAAAATTCTGA
GTTGTTACGCTTTCAGAGGACCCCTGTTAGCCGAGGGGA
Restriction Sites Please inquire     
Tag Tag Free
ACCN NM_001042355
ORF Size 2862 bp
Insert Size 3500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001042355.1, NP_001035814
RefSeq Size 8584
RefSeq ORF 2862
Locus ID 1540
Cytogenetics 16q12.1
Protein Families Druggable Genome
Protein Pathways RIG-I-like receptor signaling pathway
Gene Summary This gene is encodes a cytoplasmic protein with three cytoskeletal-associated protein-glycine-conserved (CAP-GLY) domains that functions as a deubiquitinating enzyme. Mutations in this gene have been associated with cylindromatosis, multiple familial trichoepithelioma, and Brooke-Spiegler syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) lacks one exon in the 5' UTR and a second in-frame exon in the coding region, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Variants 2 and 3 encode the same isoform.

Other Versions

Other products for "CYLD"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies