FOXO3 (NM_201559) Human Untagged Clone

CAT#: SC320321

Reviews ()
Write a review

FOXO3 (untagged)-Human forkhead box O3 (FOXO3), transcript variant 2



  "NM_201559" in other vectors (7)

Reconstitution Protocol

USD 617.00

In Stock*

Size
    • 10 ug

Product images

Other products for "FOXO3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FOXO3
Synonyms AF6q21; FKHRL1; FKHRL1P2; FOXO2; FOXO3A
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_201559.1 GGGAGGAGGAGGAATGTGGAAGGTGGCGGCGCGCGAGCTGACAGGCGGTTCCTCGGGCGG
GCTGCGGCGACGGCCCGAGCGCTTCTCCTTCGCCGAGGTTGCGCGCCCCCTCCTCGCCGT
GCCCCGGGCCCGCGCGGGATCGTGCGTCGTCCCGCCGCGTCCCTGAAGGGAAGGAAGCGA
GGCGGCGGCGGCGGCGCCCGGGAGCCGGAGCCTTCGCGGCGTCCACGTCCCTCCCCCGCT
GCACCCCGCCCCGGCGCGAGAGGAGAGCGCGAGAGCCCCAGCCGCGGGCGGGCGGGCGGC
GAAGATGGCAGAGGCACCGGCTTCCCCGGCCCCGCTCTCTCCGCTCGAAGTGGAGCTGGA
CCCGGAGTTCGAGCCCCAGAGCCGTCCGCGATCCTGTACGTGGCCCCTGCAAAGGCCGGA
GCTCCAAGCGAGCCCTGCCAAGCCCTCGGGGGAGACGGCCGCCGACTCCATGATCCCCGA
GGAGGAGGACGATGAAGACGACGAGGACGGCGGGGGACGGGCCGGCTCGGCCATGGCGAT
CGGCGGCGGCGGCGGGAGCGGCACGCTGGGCTCCGGGCTGCTCCTTGAGGACTCGGCCCG
GGTGCTGGCACCCGGAGGGCAAGACCCCGGGTCTGGGCCAGCCACCGCGGCGGGCGGGCT
GAGCGGGGGTACACAGGCGCTGCTGCAGCCTCAGCAACCGCTGCCACCGCCGCAGCCGGG
GGCGGCTGGGGGCTCCGGGCAGCCGAGGAAATGTTCGTCGCGGCGGAACGCCTGGGGAAA
CCTGTCCTACGCGGACCTGATCACCCGCGCCATCGAGAGCTCCCCGGACAAACGGCTCAC
TCTGTCCCAGATCTACGAGTGGATGGTGCGTTGCGTGCCCTACTTCAAGGATAAGGGCGA
CAGCAACAGCTCTGCCGGCTGGAAGAACTCCATCCGGCACAACCTGTCACTGCATAGTCG
ATTCATGCGGGTCCAGAATGAGGGAACTGGCAAGAGCTCTTGGTGGATCATCAACCCTGA
TGGGGGGAAGAGCGGAAAAGCCCCCCGGCGGCGGGCTGTCTCCATGGACAATAGCAACAA
GTATACCAAGAGCCGTGGCCGCGCAGCCAAGAAGAAGGCAGCCCTGCAGACAGCCCCCGA
ATCAGCTGACGACAGTCCCTCCCAGCTCTCCAAGTGGCCTGGCAGCCCCACGTCACGCAG
CAGTGATGAGCTGGATGCGTGGACGGACTTCCGTTCACGCACCAATTCTAACGCCAGCAC
AGTCAGTGGCCGCCTGTCGCCCATCATGGCAAGCACAGAGTTGGATGAAGTCCAGGACGA
TGATGCGCCTCTCTCGCCCATGCTCTACAGCAGCTCAGCCAGCCTGTCACCTTCAGTAAG
CAAGCCGTGCACGGTGGAACTGCCACGGCTGACTGATATGGCAGGCACCATGAATCTGAA
TGATGGGCTGACTGAAAACCTCATGGACGACCTGCTGGATAACATCACGCTCCCGCCATC
CCAGCCATCGCCCACTGGGGGACTCATGCAGCGGAGCTCTAGCTTCCCGTATACCACCAA
GGGCTCGGGCCTGGGCTCCCCAACCAGCTCCTTTAACAGCACGGTGTTCGGACCTTCATC
TCTGAACTCCCTACGCCAGTCTCCCATGCAGACCATCCAAGAGAACAAGCCAGCTACCTT
CTCTTCCATGTCACACTATGGTAACCAGACACTCCAGGACCTGCTCACTTCGGACTCACT
TAGCCACAGCGATGTCATGATGACACAGTCGGACCCCTTGATGTCTCAGGCCAGCACCGC
TGTGTCTGCCCAGAATTCCCGCCGGAACGTGATGCTTCGCAATGATCCGATGATGTCCTT
TGCTGCCCAGCCTAACCAGGGAAGTTTGGTCAATCAGAACTTGCTCCACCACCAGCACCA
AACCCAGGGCGCTCTTGGTGGCAGCCGTGCCTTGTCGAATTCTGTCAGCAACATGGGCTT
GAGTGAGTCCAGCAGCCTTGGGTCAGCCAAACACCAGCAGCAGTCTCCTGTCAGCCAGTC
TATGCAAACCCTCTCGGACTCTCTCTCAGGCTCCTCCTTGTACTCAACTAGTGCAAACCT
GCCCGTCATGGGCCATGAGAAGTTCCCCAGCGACTTGGACCTGGACATGTTCAATGGGAG
CTTGGAATGTGACATGGAGTCCATTATCCGTAGTGAACTCATGGATGCTGATGGGTTGGA
TTTTAACTTTGATTCCCTCATCTCCACACAGAATGTTGTTGGTTTGAACGTGGGGAACTT
CACTGGTGCTAAGCAGGCCTCATCTCAGAGCTGGGTGCCAGGCTGAAGGATCACTGAGGA
AGGGGAAGTGGGCAAAGCAGACCCTCAAACTGACACAAGACCTACAGAGAAAACCCTTTG
CCAAATCTGCTCTCAGCAAGTGGACAGTGATACCGTTTACAGCTTAACACCTTTGTGAAT
CCCACGCCATTTTCCTAACCCAGCAGAGACTGTTAATGGCCCCTTACCCTGGGTGAAGCA
CTTACCCTTGGAACAGAACTCTAAAAAGTATGCAAAATCTTCCTTGTACAGGGTGGTGAG
CCGCCTGCCAGTGGAGGACAGCACCCCTCAGCACCACCCACCCTCATTCAGAGCACACCG
TGAGCCCCCGTCGGCCATTCTGTGGTGTTTTAATATTGCGATGGTTTATGGGACGTTTTA
AGTGTTGTTCTTGTGTTTGTTTTCCTTTGACTTTCTGAGTTTTTCACATGCATTAACTTG
CGGTATTTTTCTGTTAAAATGTTAACCGTCCTTCCCCTAGCAAATTTAAAAACAGAAAGA
AAATGTTGTACCAGTTACCATTCCGGGTTCGAGCATCACAAGCTTTTGAGCGCATGGAAC
TCCATAAACTAACAAATTACATAAACTAAAGGGGGATTTTCTTTCTTCTTTTGTTTGGTA
GAAAATTATCCTTTTCTAAAAACTGAACAATGGCACAATTGTTTGCTATGTGCACCCGTC
CAGGACAGAACCGTGCATAGGCAAAAGGAGTGGAGCACAGCGTCCGGCCCAGTGTGTTTC
CGGTTCTGAGTCAGGGTGATCTGTGGACGGGACCCCAGCACCAAGTCTACGGGTGCCAGA
TCAGTAGGGCCTGTGATTTCCTGTCAGTGTCCTCAGCTAATGTGAACAGTGTTGGTCTGC
TGGTTAGAAACTAGAATATTGATATTTTCAGGAAAGAAATCAGCTCAGCTCTCCACTCAT
TGCCAAATGTCACTAAAGGGTTTAGTTTTAAGGAGAAAGAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_201559
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_201559.1, NP_963853.1
RefSeq Size 3311 bp
RefSeq ORF 2022 bp
Locus ID 2309
UniProt ID O43524
Cytogenetics 6q21
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Chemokine signaling pathway, Endometrial cancer, Neurotrophin signaling pathway, Non-small cell lung cancer
Gene Summary This gene belongs to the forkhead family of transcription factors which are characterized by a distinct forkhead domain. This gene likely functions as a trigger for apoptosis through expression of genes necessary for cell death. Translocation of this gene with the MLL gene is associated with secondary acute leukemia. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' end compared to variant 1. Both variants encode the same protein.

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.