ARD1A (NAA10) (NM_003491) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | ARD1A |
Synonyms | ARD1; ARD1A; ARD1P; DXS707; hARD1; MCOPS1; NATD; OGDNS; TE2 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>OriGene sequence for NM_003491.2
AGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGTCGCTTCGGAGCGCGGCGGC
AGCTGACTGCGCCTTCACGATCCGCTGGGACCCGCGAGCCCCGCCGCCGTTATGAACATC CGCAATGCGAGGCCAGAGGACCTAATGAACATGCAGCACTGCAACCTCCTCTGCCTGCCC GAGAACTACCAGATGAAATACTACTTCTACCATGGCCTTTCCTGGCCCCAGCTCTCTTAC ATTGCTGAGGACGAGAATGGGAAGATTGTGGGGTATGTCCTGGCCAAAATGGAAGAGGAC CCAGATGATGTGCCCCATGGACATATCACCTCATTGGCTGTGAAGCGTTCCCACCGGCGC CTCGGTCTGGCTCAGAAACTGATGGACCAGGCCTCTCGAGCCATGATAGAGAACTTCAAT GCCAAATATGTCTCCCTGCATGTCAGGAAGAGTAACCGGGCCGCCCTGCACCTCTATTCC AACACCCTCAACTTTCAGATCAGTGAAGTGGAGCCCAAATACTATGCAGATGGGGAGGAC GCCTATGCCATGAAGCGGGACCTCACTCAGATGGCCGACGAGCTGAGGCGGCACCTGGAG CTGAAAGAGAAGGGCAGGCACGTGGTGCTGGGTGCCATCGAGAACAAGGTGGAGAGCAAA GGCAATTCACCTCCGAGCTCAGGAGAGGCCTGTCGCGAGGAGAAGGGCCTGGCTGCCGAG GATAGTGGTGGGGACAGCAAGGACCTCAGCGAGGTCAGCGAGACCACAGAGAGCACAGAT GTCAAGGACAGCTCAGAGGCCTCCGACTCAGCCTCCTAGAGCCTGCCCCATCCCCTCCTC ACCCCACGAGCTTTCACAATAAATTTGCTCCGTGGCACTGGGAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_003491 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_003491.2, NP_003482.1 |
RefSeq Size | 916 bp |
RefSeq ORF | 708 bp |
Locus ID | 8260 |
UniProt ID | P41227 |
Cytogenetics | Xq28 |
Domains | Acetyltransf |
Protein Families | Druggable Genome |
Protein Pathways | Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism |
Summary | N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes an N-terminal acetyltransferase that functions as the catalytic subunit of the major amino-terminal acetyltransferase A complex. Mutations in this gene are the cause of Ogden syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC201354 | NAA10 (Myc-DDK-tagged)-Human N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10) | 10 ug |
$300.00
|
|
RC201354L1 | Lenti ORF clone of Human N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC201354L2 | Lenti ORF clone of Human N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), mGFP tagged | 10 ug |
$600.00
|
|
RC201354L3 | Lenti ORF clone of Human N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), Myc-DDK-tagged | 10 ug |
$600.00
|
|
RC201354L4 | Lenti ORF clone of Human N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), mGFP tagged | 10 ug |
$600.00
|
|
RG201354 | NAA10 (tGFP-tagged) - Human N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10) | 10 ug |
$489.00
MSRP
$500.00
MSRP
$500.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.