TM4SF4 (NM_004617) Human Untagged Clone

SKU
SC320227
TM4SF4 (untagged)-Human transmembrane 4 L six family member 4 (TM4SF4)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TM4SF4
Synonyms il-TMP; ILTMP
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004617.2 GGCACGAGGGAAGCAACTCCAAGGACACAGTTCACAGAAATTTGGTTCTCAGCCCCAAAA
TACTGATTGAATTGGAGACAATTACAAGGACTCTCTGGCCAAAAACCCTTGAAGAGGCCC
CGTGAAGGAGGCAGTGAGGAGCTTTTGATTGCTGACCTGTGTCGTACCACCCCAGAATGT
GCACTGGGGGCTGTGCCAGATGCCTGGGGGGGACCCTCATTCCCCTTGCTTTTTTTGGCT
TCCTGGCTAACATCCTGTTATTTTTTCCTGGAGGAAAAGTGATAGATGACAACGACCACC
TTTCCCAAGAGATCTGGTTTTTCGGAGGAATATTAGGAAGCGGTGTCTTGATGATCTTCC
CTGCGCTGGTGTTCTTGGGCCTGAAGAACAATGACTGCTGTGGGTGCTGCGGCAACGAGG
GCTGTGGGAAGCGATTTGCGATGTTCACCTCCACGATATTTGCTGTGGTTGGATTCTTGG
GAGCTGGATACTCGTTTATCATCTCAGCCATTTCAATCAACAAGGGTCCTAAATGCCTCA
TGGCCAATAGTACATGGGGCTACCCCTTCCACGACGGGGATTATCTCAATGATGAGGCCT
TATGGAACAAGTGCCGAGAGCCTCTCAATGTGGTTCCCTGGAATCTGACCCTCTTCTCCA
TCCTGCTGGTCGTAGGAGGAATCCAGATGGTTCTCTGCGCCATCCAGGTGGTCAATGGCC
TCCTGGGGACCCTCTGTGGGGACTGCCAGTGTTGTGGCTGCTGTGGGGGAGATGGACCCG
TTTAAACCTCCGAGATGAGCTGCTCAGACTCTACAGCATGACGACTACAATTTCTTTTCA
TAAAACTTCTTCTCTTCTTGGAATTATTAATTCCTATCTGCTTCCTAGCTGATAAAGCTT
AGAAAAGGCAGTTATTCCTTCTTTCCAACCAGCTTTGCTCGAGTTAGAATTTTGTTATTT
TCAAATAAAAAATAGTTTGGCCACTTAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_004617
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004617.2, NP_004608.1
RefSeq Size 1428 bp
RefSeq ORF 609 bp
Locus ID 7104
UniProt ID P48230
Cytogenetics 3q25.1
Protein Families Transmembrane
Summary The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that can regulate cell proliferation.[provided by RefSeq, Mar 2011]
Write Your Own Review
You're reviewing:TM4SF4 (NM_004617) Human Untagged Clone
Your Rating
SKU Description Size Price
RC200346 TM4SF4 (Myc-DDK-tagged)-Human transmembrane 4 L six family member 4 (TM4SF4) 10 ug
$450.00
RC200346L1 Lenti ORF clone of Human transmembrane 4 L six family member 4 (TM4SF4), Myc-DDK-tagged 10 ug
$750.00
RC200346L2 Lenti ORF clone of Human transmembrane 4 L six family member 4 (TM4SF4), mGFP tagged 10 ug
$750.00
RC200346L3 Lenti ORF clone of Human transmembrane 4 L six family member 4 (TM4SF4), Myc-DDK-tagged 10 ug
$750.00
RC200346L4 Lenti ORF clone of Human transmembrane 4 L six family member 4 (TM4SF4), mGFP tagged 10 ug
$750.00
RG200346 TM4SF4 (tGFP-tagged) - Human transmembrane 4 L six family member 4 (TM4SF4) 10 ug
$650.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.