UFD1 (NM_005659) Human Untagged Clone
CAT#: SC320168
UFD1L (untagged)-Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 1
"NM_005659" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | UFD1 |
Synonyms | UFD1L |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_005659.5
GGCGGCTGGGAGAGCGGTCGGCGGGGTTTCTTCGTTGCATTGCCTGAGAGGAGCGGAGTC
TGCCAGGTGGTGTCCATCATGTTCTCTTTCAACATGTTCGACCACCCTATTCCCAGGGTC TTCCAAAACCGCTTCTCCACACAGTACCGCTGCTTCTCTGTGTCCATGCTAGCAGGGCCT AATGACAGGTCAGATGTGGAGAAAGGAGGGAAGATAATTATGCCACCCTCGGCCCTGGAC CAACTCAGCCGACTTAACATTACCTATCCCATGCTGTTCAAACTGACCAATAAGAATTCG GACCGCATGACGCATTGTGGCGTGCTGGAGTTTGTGGCTGATGAGGGCATCTGCTACCTC CCACACTGGATGATGCAGAACTTACTCTTGGAAGAAGGCGGCCTGGTCCAGGTGGAGAGC GTCAACCTTCAAGTGGCCACCTACTCCAAATTCCAACCTCAGAGCCCTGACTTCCTGGAC ATCACCAACCCCAAAGCCGTATTAGAAAACGCACTTAGGAACTTTGCCTGTCTGACCACC GGGGATGTGATTGCCATCAACTATAATGAAAAGATCTACGAACTGCGTGTGATGGAGACC AAACCCGACAAGGCAGTGTCCATCATTGAGTGTGACATGAACGTGGACTTTGATGCTCCC CTGGGCTACAAAGAACCCGAAAGACAAGTCCAGCATGAGGAGTCGACAGAAGGTGAAGCC GACCACAGTGGCTATGCTGGAGAGCTGGGCTTCCGCGCTTTCTCTGGATCTGGCAATAGA CTGGATGGAAAGAAGAAAGGGGTAGAGCCCAGCCCCTCCCCAATCAAGCCTGGAGATATT AAAAGAGGAATTCCCAATTATGAATTTAAACTTGGTAAGATAACTTTCATCAGAAATTCA CGTCCCCTTGTCAAAAAGGTTGAAGAGGATGAAGCTGGAGGCAGATTCGTCGCTTTCTCT GGAGAAGGACAGTCATTGCGTAAAAAGGGAAGAAAGCCCTAAGTGAGGACTGTTGGCTGA TTGGAAAATAATAAAAGAATCATTTGCAACAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_005659 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005659.5, NP_005650.2 |
RefSeq Size | 1534 bp |
RefSeq ORF | 924 bp |
Locus ID | 7353 |
UniProt ID | Q92890 |
Cytogenetics | 22q11.21 |
Domains | UFD1 |
Gene Summary | The protein encoded by this gene forms a complex with two other proteins, nuclear protein localization-4 and valosin-containing protein, and this complex is necessary for the degradation of ubiquitinated proteins. In addition, this complex controls the disassembly of the mitotic spindle and the formation of a closed nuclear envelope after mitosis. Mutations in this gene have been associated with Catch 22 syndrome as well as cardiac and craniofacial defects. Alternative splicing results in multiple transcript variants encoding different isoforms. A related pseudogene has been identified on chromosome 18. [provided by RefSeq, Jun 2009] Transcript Variant: This variant (1)encodes the longest isoform (A). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202989 | UFD1L (Myc-DDK-tagged)-Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 1 |
USD 450.00 |
|
RC202989L1 | Lenti ORF clone of Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
RC202989L2 | Lenti ORF clone of Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 1, mGFP tagged |
USD 750.00 |
|
RC202989L3 | Lenti ORF clone of Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 1, Myc-DDK-tagged |
USD 750.00 |
|
RC202989L4 | Lenti ORF clone of Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 1, mGFP tagged |
USD 750.00 |
|
RG202989 | UFD1L (tGFP-tagged) - Human ubiquitin fusion degradation 1 like (yeast) (UFD1L), transcript variant 1 |
USD 650.00 |
{0} Product Review(s)
Be the first one to submit a review