Lactate Dehydrogenase B (LDHB) (NM_002300) Human Untagged Clone

SKU
SC319772
LDHB (untagged)-Human lactate dehydrogenase B (LDHB), transcript variant 1
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Lactate Dehydrogenase B
Synonyms HEL-S-281; LDH-B; LDH-H; LDHBD; TRG-5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002300.3 GGGGCTTGCAGAGCCGGCGCCGGAGGAGACGCACGCAGCTGACTTTGTCTTCTCCGCACG
ACTGTTACAGAGGTCTCCAGAGCCTTCTCTCTCCTGTGCAAAATGGCAACTCTTAAGGAA
AAACTCATTGCACCAGTTGCGGAAGAAGAGGCAACAGTTCCAAACAATAAGATCACTGTA
GTGGGTGTTGGACAAGTTGGTATGGCGTGTGCTATCAGCATTCTGGGAAAGTCTCTGGCT
GATGAACTTGCTCTTGTGGATGTTTTGGAAGATAAGCTTAAAGGAGAAATGATGGATCTG
CAGCATGGGAGCTTATTTCTTCAGACACCTAAAATTGTGGCAGATAAAGATTATTCTGTG
ACCGCCAATTCTAAGATTGTAGTGGTAACTGCAGGAGTCCGTCAGCAAGAAGGGGAGAGT
CGGCTCAATCTGGTGCAGAGAAATGTTAATGTCTTCAAATTCATTATTCCTCAGATCGTC
AAGTACAGTCCTGATTGCATCATAATTGTGGTTTCCAACCCAGTGGACATTCTTACGTAT
GTTACCTGGAAACTAAGTGGATTACCCAAACACCGCGTGATTGGAAGTGGATGTAATCTG
GATTCTGCTAGATTTCGCTACCTTATGGCTGAAAAACTTGGCATTCATCCCAGCAGCTGC
CATGGATGGATTTTGGGGGAACATGGCGACTCAAGTGTGGCTGTGTGGAGTGGTGTGAAT
GTGGCAGGTGTTTCTCTCCAGGAATTGAATCCAGAAATGGGAACTGACAATGATAGTGAA
AATTGGAAGGAAGTGCATAAGATGGTGGTTGAAAGTGCCTATGAAGTCATCAAGCTAAAA
GGATATACCAACTGGGCTATTGGATTAAGTGTGGCTGATCTTATTGAATCCATGTTGAAA
AATCTATCCAGGATTCATCCCGTGTCAACAATGGTAAAGGGGATGTATGGCATTGAGAAT
GAAGTCTTCCTGAGCCTTCCATGTATCCTCAATGCCCGGGGATTAACCAGCGTTATCAAC
CAGAAGCTAAAGGATGATGAGGTTGCTCAGCTCAAGAAAAGTGCAGATACCCTGTGGGAC
ATCCAGAAGGACCTAAAAGACCTGTGACTAGTGAGCTCTAGGCTGTAGAAATTTAAAAAC
TACAATGTGATTAACTCGAGCCTTTAGTTTTCATCCATGTACATGGATCACAGTTTGCTT
TGATCTTCTTCAATATGTGAATTTGGGCTCACAGAATCAAAGCCTATGCTTGGTTTAATG
CTTGCAATCTGAGCTCTTGAACAAATAAAATTAACTATTGTAGTGCGAAAAAAAAAAAAA
AAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_002300
Insert Size 1005 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002300.3, NP_002291.1
RefSeq Size 1336 bp
RefSeq ORF 1005 bp
Locus ID 3945
UniProt ID P07195
Cytogenetics 12p12.1
Domains ldh
Protein Families Druggable Genome
Protein Pathways Cysteine and methionine metabolism, Glycolysis / Gluconeogenesis, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism
Summary This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Mutations in this gene are associated with lactate dehydrogenase B deficiency. Pseudogenes have been identified on chromosomes X, 5 and 13. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes two isoforms, which result from the use of alternative in-frame translation termination codons. The shorter isoform (LDHB) results from translation termination at the upstream UGA stop codon, while the longer isoform (LDHBx) results from UGA stop codon readthrough to the downstream UAG termination codon. This RefSeq represents the shorter isoform (LDHB), which is localized in the cytosol. Variants 1 and 2 encode the same isoform.
Write Your Own Review
You're reviewing:Lactate Dehydrogenase B (LDHB) (NM_002300) Human Untagged Clone
Your Rating
SKU Description Size Price
RC205074 LDHB (Myc-DDK-tagged)-Human lactate dehydrogenase B (LDHB), transcript variant 1 10 ug
$686.00
RC205074L1 Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC205074L2 Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, mGFP tagged 10 ug
$986.00
RC205074L3 Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC205074L4 Lenti ORF clone of Human lactate dehydrogenase B (LDHB), transcript variant 1, mGFP tagged 10 ug
$986.00
RG205074 LDHB (tGFP-tagged) - Human lactate dehydrogenase B (LDHB), transcript variant 1 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.