Cyclin H (CCNH) (NM_001239) Human Untagged Clone

SKU
SC319745
CCNH (untagged)-Human cyclin H (CCNH), transcript variant 1
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Cyclin H
Synonyms CAK; CycH; p34; p37
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001239.2 GGGGGGTGGGGGTACGGGTGTTTTACGCCAGGACGCTGATGCGTTTGGGTTCTCGTCTGC
AGACCCTCTGGACCTGGTCACGATTCCATAATGTACCACAACAGTAGTCAGAAGCGGCAC
TGGACCTTCTCCAGCGAGGAGCAGCTGGCAAGACTGCGGGCTGACGCCAACCGCAAATTC
AGATGCAAAGCCGTGGCCAACGGGAAGGTTCTTCCGAATGATCCAGTCTTTCTTGAGCCT
CATGAAGAAATGACACTCTGCAAATACTATGAGAAAAGGTTATTGGAATTCTGTTCGGTG
TTTAAGCCAGCAATGCCAAGATCTGTTGTGGGTACGGCTTGTATGTATTTCAAACGTTTT
TATCTTAATAACTCAGTAATGGAATATCACCCCAGGATAATAATGCTCACTTGTGCATTT
TTGGCCTGCAAAGTAGATGAATTCAATGTATCTAGTCCTCAGTTTGTTGGAAACCTCCGG
GAGAGTCCTCTTGGACAGGAGAAGGCACTTGAACAGATACTGGAATATGAACTACTTCTT
ATACAGCAACTTAATTTCCACCTTATTGTCCACAATCCTTACAGACCATTTGAGGGCTTC
CTCATCGACTTAAAGACCCGCTATCCCATATTGGAGAATCCAGAGATTTTGAGGAAAACA
GCTGATGACTTTCTTAATAGAATTGCATTGACGGATGCTTACCTTTTATACACGCCTTCC
CAAATTGCCCTGACTGCCATTTTATCTAGTGCCTCCAGGGCTGGAATTACTATGGAAAGT
TATTTATCAGAGAGTCTGATGCTGAAAGAGAACAGAACTTGCCTGTCACAGTTACTAGAT
ATAATGAAAAGCATGAGAAACTTAGTAAAGAAGTATGAACCACCCAGATCTGAAGAAGTT
GCTGTTCTGAAACAGAAGTTGGAGCGATGTCATTCTGCTGAGCTTGCACTTAACGTAATC
ACGAAGAAGAGGAAAGGCTATGAAGATGATGATTACGTCTCAAAGAAATCCAAACATGAG
GAGGAAGAGTGGACTGATGACGACCTGGTAGAATCTCTCTAACCATTTGAAGTTGATTTC
TCAATGCTAACTAATCAAGAGAAGTAGGAAGCATATCAAACGTTTAACTTTATTTAAAAA
GTATAATGTGAAAACATAAAATATATTAAAACTTTTCTATTGTTTTCTTTCCCTTTCACA
GTAACTTTATGTAAAATAAACCATCTTCAAAAGAGCTAGAATACCAAAAAAAAAAAAAAA
AAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_001239
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001239.2, NP_001230.1
RefSeq Size 1398 bp
RefSeq ORF 972 bp
Locus ID 902
UniProt ID P51946
Cytogenetics 5q14.3
Domains cyclin, CYCLIN
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Cell cycle, Nucleotide excision repair
Summary The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK7 kinase and ring finger protein MAT1. The kinase complex is able to phosphorylate CDK2 and CDC2 kinases, thus functions as a CDK-activating kinase (CAK). This cyclin and its kinase partner are components of TFIIH, as well as RNA polymerase II protein complexes. They participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery. A pseudogene of this gene is found on chromosome 4. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) differs in the 3' UTR and coding sequence compared to variant 3. The resulting isoform (1) has a shorter and distinct C-terminus compared to isoform 3.
Write Your Own Review
You're reviewing:Cyclin H (CCNH) (NM_001239) Human Untagged Clone
Your Rating
SKU Description Size Price
RC204982 CCNH (Myc-DDK-tagged)-Human cyclin H (CCNH), transcript variant 1 10 ug
$300.00
RC204982L3 Lenti ORF clone of Human cyclin H (CCNH), transcript variant 1, Myc-DDK-tagged 10 ug
$600.00
RC204982L4 Lenti ORF clone of Human cyclin H (CCNH), transcript variant 1, mGFP tagged 10 ug
$600.00
RG204982 CCNH (tGFP-tagged) - Human cyclin H (CCNH), transcript variant 1 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.