PCMT1 (NM_005389) Human Untagged Clone

CAT#: SC319500

PCMT1 (untagged)-Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1)


  "NM_005389" in other vectors (7)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
PCMT1 mouse monoclonal antibody,clone OTI2A9
    • 100 ul

USD 447.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "PCMT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PCMT1
Synonyms PIMT
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_005389.1 GGAGGTGGTCTCACTCTTGGGAAAACTGCTGGGCACCGTCGTCGCGCTGAAGGTGGTTCT
GTACCTGCTCCGAGTGTGCTTAGCGATGGCCTGGAAATCCGGCGGCGCCAGCCACTCGGA
GCTAATCCACAATCTCCGCAAAAATGGAATCATCAAGACAGATAAAGTATTTGAAGTGAT
GCTGGCTACAGACCGCTCCCACTATGCAAAATGTAACCCATACATGGATTCTCCACAATC
AATAGGTTTCCAAGCAACAATCAGTGCTCCACACATGCATGCATATGCGCTAGAACTTCT
ATTTGATCAGTTGCATGAAGGAGCTAAAGCTCTTGATGTAGGATCTGGAAGTGGAATCCT
TACTGCATGTTTTGCACGTATGGTTGGATGTACTGGAAAAGTCATAGGAATTGATCACAT
TAAAGAGCTAGTAGATGACTCAATAAATAATGTCAGGAAGGACGATCCAACACTTCTGTC
TTCAGGGAGAGTACAGCTTGTTGTGGGGGATGGAAGAATGGGATATGCTGAAGAAGCCCC
TTATGATGCCATTCATGTGGGAGCTGCAGCCCCTGTTGTACCCCAGGCGCTAATAGATCA
GTTAAAGCCCGGAGGAAGATTGATATTGCCTGTTGGTCCTGCAGGCGGAAACCAAATGTT
GGAGCAGTATGACAAGCTACAAGATGGCAGCATCAAAATGAAGCCTCTGATGGGGGTGAT
ATACGTGCCTTTAACAGATAAAGAAAAGCAGTGGTCCAGGTGGAAGTGATTTTATCTTCT
GCTCTTTCTTCTTCCACACATGCAAGGGATGAATTGTAAAAGCAACATCAGCTTGACCAG
TATAAAATTACAGTGGATTGCTCATCTCAGTCCTCAAAGCTTTTTGAAAACCAACACCAT
CACAGCTTGTTTTGGACTTTGTTACACTGTTATTTTCAGCATGAAAATGTGTGTTTTTTT
AGGGTTTCTGATTCTTCAAAGAGGCACAGAGCCAAATTGGTAGAGGAAGGATGCAAAGTA
TAAATTTGTGTAATATTACTTTAACATGCCCATATTTTACTTGGAAATATTAAAAGAAAG
GGTTCTGTAAAATGGAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_005389
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005389.1, NP_005380.1
RefSeq Size 1751 bp
RefSeq ORF 684 bp
Locus ID 5110
UniProt ID P22061
Cytogenetics 6q25.1
Domains PCMT
Protein Families Druggable Genome
Gene Summary This gene encodes a member of the type II class of protein carboxyl methyltransferase enzymes. The encoded enzyme plays a role in protein repair by recognizing and converting D-aspartyl and L-isoaspartyl residues resulting from spontaneous deamidation back to the normal L-aspartyl form. The encoded protein may play a protective role in the pathogenesis of Alzheimer's disease, and single nucleotide polymorphisms in this gene have been associated with spina bifida and premature ovarian failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 6 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.