PCMT1 (NM_005389) Human Untagged Clone
CAT#: SC319500
PCMT1 (untagged)-Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1)
"NM_005389" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PCMT1 |
Synonyms | PIMT |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_005389.1
GGAGGTGGTCTCACTCTTGGGAAAACTGCTGGGCACCGTCGTCGCGCTGAAGGTGGTTCT
GTACCTGCTCCGAGTGTGCTTAGCGATGGCCTGGAAATCCGGCGGCGCCAGCCACTCGGA GCTAATCCACAATCTCCGCAAAAATGGAATCATCAAGACAGATAAAGTATTTGAAGTGAT GCTGGCTACAGACCGCTCCCACTATGCAAAATGTAACCCATACATGGATTCTCCACAATC AATAGGTTTCCAAGCAACAATCAGTGCTCCACACATGCATGCATATGCGCTAGAACTTCT ATTTGATCAGTTGCATGAAGGAGCTAAAGCTCTTGATGTAGGATCTGGAAGTGGAATCCT TACTGCATGTTTTGCACGTATGGTTGGATGTACTGGAAAAGTCATAGGAATTGATCACAT TAAAGAGCTAGTAGATGACTCAATAAATAATGTCAGGAAGGACGATCCAACACTTCTGTC TTCAGGGAGAGTACAGCTTGTTGTGGGGGATGGAAGAATGGGATATGCTGAAGAAGCCCC TTATGATGCCATTCATGTGGGAGCTGCAGCCCCTGTTGTACCCCAGGCGCTAATAGATCA GTTAAAGCCCGGAGGAAGATTGATATTGCCTGTTGGTCCTGCAGGCGGAAACCAAATGTT GGAGCAGTATGACAAGCTACAAGATGGCAGCATCAAAATGAAGCCTCTGATGGGGGTGAT ATACGTGCCTTTAACAGATAAAGAAAAGCAGTGGTCCAGGTGGAAGTGATTTTATCTTCT GCTCTTTCTTCTTCCACACATGCAAGGGATGAATTGTAAAAGCAACATCAGCTTGACCAG TATAAAATTACAGTGGATTGCTCATCTCAGTCCTCAAAGCTTTTTGAAAACCAACACCAT CACAGCTTGTTTTGGACTTTGTTACACTGTTATTTTCAGCATGAAAATGTGTGTTTTTTT AGGGTTTCTGATTCTTCAAAGAGGCACAGAGCCAAATTGGTAGAGGAAGGATGCAAAGTA TAAATTTGTGTAATATTACTTTAACATGCCCATATTTTACTTGGAAATATTAAAAGAAAG GGTTCTGTAAAATGGAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_005389 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005389.1, NP_005380.1 |
RefSeq Size | 1751 bp |
RefSeq ORF | 684 bp |
Locus ID | 5110 |
UniProt ID | P22061 |
Cytogenetics | 6q25.1 |
Domains | PCMT |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the type II class of protein carboxyl methyltransferase enzymes. The encoded enzyme plays a role in protein repair by recognizing and converting D-aspartyl and L-isoaspartyl residues resulting from spontaneous deamidation back to the normal L-aspartyl form. The encoded protein may play a protective role in the pathogenesis of Alzheimer's disease, and single nucleotide polymorphisms in this gene have been associated with spina bifida and premature ovarian failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 6 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200327 | PCMT1 (Myc-DDK-tagged)-Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1) |
USD 300.00 |
|
RC200327L1 | Lenti ORF clone of Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1), Myc-DDK-tagged |
USD 600.00 |
|
RC200327L2 | Lenti ORF clone of Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1), mGFP tagged |
USD 600.00 |
|
RC200327L3 | Lenti ORF clone of Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1), Myc-DDK-tagged |
USD 600.00 |
|
RC200327L4 | Lenti ORF clone of Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1), mGFP tagged |
USD 600.00 |
|
RG200327 | PCMT1 (tGFP-tagged) - Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1) |
USD 500.00 |
|
SC327775 | PCMT1 (untagged)-Human protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1) |
USD 330.00 |
{0} Product Review(s)
Be the first one to submit a review