BAG1 (NM_004323) Human Untagged Clone
CAT#: SC319483
BAG1 (untagged)-Human BCL2-associated athanogene (BAG1), transcript variant 1
"NM_004323" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BAG1 |
Synonyms | BAG-1; HAP; RAP46 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004323.4
GAGACGCCGCGCTCAGCTTCCATCGCTGGGCGGTCAACAAGTGCGGGCCTGGCTCAGCGC
GGGGGGGCGCGGAGACCGCGAGGCGACCGGGAGCGGCTGGGTTCCCGGCTGCGCGCCCTT CGGCCAGGCCGGGAGCCGCGCCAGTCGGAGCCCCCGGCCCAGCGTGGTCCGCCTCCCTCT CGGCGTCCACCTGCCCGGAGTACTGCCAGCGGGCATGACCGACCCACCAGGGGCGCCGCC GCCGGCGCTCGCAGGCCGCGGATGAAGAAGAAAACCCGGCGCCGCTCGACCCGGAGCGAG GAGTTGACCCGGAGCGAGGAGTTGACCCTGAGTGAGGAAGCGACCTGGAGTGAAGAGGCG ACCCAGAGTGAGGAGGCGACCCAGGGCGAAGAGATGAATCGGAGCCAGGAGGTGACCCGG GACGAGGAGTCGACCCGGAGCGAGGAGGTGACCAGGGAGGAAATGGCGGCAGCTGGGCTC ACCGTGACTGTCACCCACAGCAATGAGAAGCACGACCTTCATGTTACCTCCCAGCAGGGC AGCAGTGAACCAGTTGTCCAAGACCTGGCCCAGGTTGTTGAAGAGGTCATAGGGGTTCCA CAGTCTTTTCAGAAACTCATATTTAAGGGAAAATCTCTGAAGGAAATGGAAACACCGTTG TCAGCACTTGGAATACAAGATGGTTGCCGGGTCATGTTAATTGGGAAAAAGAACAGTCCA CAGGAAGAGGTTGAACTAAAGAAGTTGAAACATTTGGAGAAGTCTGTGGAGAAGATAGCT GACCAGCTGGAAGAGTTGAATAAAGAGCTTACTGGAATCCAGCAGGGTTTTCTGCCCAAG GATTTGCAAGCTGAAGCTCTCTGCAAACTTGATAGGAGAGTAAAAGCCACAATAGAGCAG TTTATGAAGATCTTGGAGGAGATTGACACACTGATCCTGCCAGAAAATTTCAAAGACAGT AGATTGAAAAGGAAAGGCTTGGTAAAAAAGGTTCAGGCATTCCTAGCCGAGTGTGACACA GTGGAGCAGAACATCTGCCAGGAGACTGAGCGGCTGCAGTCTACAAACTTTGCCCTGGCC GAGTGAGGTGTAGCAGAAAAAGGCTGTGCTGCCCTGAAGAATGGCGCCACCAGCTCTGCC GTCTCTGGAGCGGAATTTACCTGATTTCTTCAGGGCTGCTGGGGGCAACTGGCCATTTGC CAATTTTCCTACTCTCACACTGGTTCTCAATGAAAAATAGTGTCTTTGTGATTTTGAGTA AAGCTCCTATCTGTTTTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004323 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004323.4, NP_004314.4 |
RefSeq Size | 3885 bp |
RefSeq ORF | 1038 bp |
Locus ID | 573 |
UniProt ID | Q99933 |
Cytogenetics | 9p13.3 |
Domains | UBQ, BAG |
Protein Families | Druggable Genome |
Gene Summary | The oncogene BCL2 is a membrane protein that blocks a step in a pathway leading to apoptosis or programmed cell death. The protein encoded by this gene binds to BCL2 and is referred to as BCL2-associated athanogene. It enhances the anti-apoptotic effects of BCL2 and represents a link between growth factor receptors and anti-apoptotic mechanisms. Multiple protein isoforms are encoded by this mRNA through the use of a non-AUG (CUG) initiation codon, and three alternative downstream AUG initiation codons. A related pseudogene has been defined on chromosome X. [provided by RefSeq, Feb 2010] Transcript Variant: This transcript (1) encodes multiple isoforms due to the use of alternative translation initiation codons. The longest isoform (BAG-1L or p50) is derived from an upstream non-AUG (CUG) start codon, while three shorter isoforms are derived from downstream AUG start codons. The longest isoform (BAG-1L) is represented in this RefSeq. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the longest human BAG1 isoform, known as BAG-1L or p50, as described in the literature, including PMIDs 9396724, 9679980, 9747877 and 17662274. This isoform initiates translation at a non-AUG (CUG) start codon that is well-conserved and present in a strong Kozak signal context. Alternative translation initiation at downstream AUG start codons produces three additional isoforms with shorter N-termini, known as BAG-1M or p46, BAG-1S or p36 (also known as p33), and p29. The most abundant of the shorter isoforms, BAG-1S, is represented by CCDS 55301.1. Evidence in PMIDs 9747877 and 17662274 indicates that these isoforms have distinct subcellular distributions, which may contribute to the multifunctionality of the protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201272 | BAG1 (Myc-DDK-tagged)-Human BCL2-associated athanogene (BAG1), transcript variant 1 |
USD 457.00 |
|
RC201272L1 | Lenti ORF clone of Human BCL2-associated athanogene (BAG1), transcript variant 1, Myc-DDK-tagged |
USD 757.00 |
|
RC201272L2 | Lenti ORF clone of Human BCL2-associated athanogene (BAG1), transcript variant 1, mGFP tagged |
USD 757.00 |
|
RC201272L3 | Lenti ORF clone of Human BCL2-associated athanogene (BAG1), transcript variant 1, Myc-DDK-tagged |
USD 757.00 |
|
RC201272L4 | Lenti ORF clone of Human BCL2-associated athanogene (BAG1), transcript variant 1, mGFP tagged |
USD 757.00 |
|
RG201272 | BAG1 (tGFP-tagged) - Human BCL2-associated athanogene (BAG1), transcript variant 1 |
USD 657.00 |
{0} Product Review(s)
Be the first one to submit a review