Geminin (GMNN) (NM_015895) Human Untagged Clone

SKU
SC319331
GMNN (untagged)-Human geminin, DNA replication inhibitor (GMNN)
$300.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Geminin
Synonyms Gem; MGORS6
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_015895.3 GTTCGGAGCGGGCGAGCGGAGTTAGCAGGGCTTTACTGCAGAGCGCGCCGGGCACTCCAG
CGACCGTGGGGATCAGCGTAGGTGAGCTGTGGCCTTTTGCGAGGTGCTGCAGCCATAGCT
ACGTGCGTTCGCTACGAGGATTGAGCGTCTCCACCCAGTAAGTGGGCAAGAGGCGGCAGG
AAGTGGGTACGCAGGGGCGCAAGGCGCACAGCCTCTAGACGACTCGCTTTCCCTCCGGCC
AACCTCTGAAGCCGCGTCCTACTTTGACAGCTGCAGGGCCGCGGCCTGGTCTTCTGTGCT
TCACCATCTACATAATGAATCCCAGTATGAAGCAGAAACAAGAAGAAATCAAAGAGAATA
TAAAGAATAGTTCTGTCCCAAGAAGAACTCTGAAGATGATTCAGCCTTCTGCATCTGGAT
CTCTTGTTGGAAGAGAAAATGAGCTGTCCGCAGGCTTGTCCAAAAGGAAACATCGGAATG
ACCACTTAACATCTACAACTTCCAGCCCTGGGGTTATTGTCCCAGAATCTAGTGAAAATA
AAAATCTTGGAGGAGTCACCCAGGAGTCATTTGATCTTATGATTAAAGAAAATCCATCCT
CTCAGTATTGGAAGGAAGTGGCAGAAAAACGGAGAAAGGCGCTGTATGAAGCACTTAAGG
AAAATGAGAAACTTCATAAAGAAATTGAACAAAAGGACAATGAAATTGCCCGCCTGAAAA
AGGAGAATAAAGAACTGGCAGAAGTAGCAGAACATGTACAGTATATGGCAGAGCTAATAG
AGAGACTGAATGGTGAACCTCTGGATAATTTTGAATCACTGGATAATCAGGAATTTGATT
CTGAAGAAGAAACTGTTGAGGATTCTCTAGTGGAAGACTCAGAAATTGGCACGTGTGCTG
AAGGAACTGTATCTTCCTCTACGGATGCAAAGCCATGTATATGAAATGCATTAATATTTG
ACTGTTGAGAATTTTACTGCCGAAGTTTACCTCCACTAGTTCTTTGTAGCAGAGTACATA
ACTACATAATGCCAACTCTGGAATCAAATTTCCTTGTTTGAATCCTGGGACCCTATTGCA
TTAAAGTACAAATACTATGTATTTTTAATCTATGATGGTTTATGTGAATAGGATTTTCTC
AGTTGTCAGCCATGACTTATGTTTATTACTAAATAAACTTCAAACTCCTGTGGAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire
ACCN NM_015895
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_015895.3, NP_056979.1
RefSeq Size 1215 bp
RefSeq ORF 630 bp
Locus ID 51053
UniProt ID O75496
Cytogenetics 6p22.3
Protein Families Druggable Genome, Stem cell - Pluripotency
Summary This gene encodes a protein that plays a critical role in cell cycle regulation. The encoded protein inhibits DNA replication by binding to DNA replication factor Cdt1, preventing the incorporation of minichromosome maintenance proteins into the pre-replication complex. The encoded protein is expressed during the S and G2 phases of the cell cycle and is degraded by the anaphase-promoting complex during the metaphase-anaphase transition. Increased expression of this gene may play a role in several malignancies including colon, rectal and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and two pseudogenes of this gene are located on the short arm of chromosome 16. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, 3 and 4 encode the same protein.
Write Your Own Review
You're reviewing:Geminin (GMNN) (NM_015895) Human Untagged Clone
Your Rating
SKU Description Size Price
RC202808 GMNN (Myc-DDK-tagged)-Human geminin, DNA replication inhibitor (GMNN) 10 ug
$300.00
RC202808L1 Lenti ORF clone of Human geminin, DNA replication inhibitor (GMNN), Myc-DDK-tagged 10 ug
$600.00
RC202808L2 Lenti ORF clone of Human geminin, DNA replication inhibitor (GMNN), mGFP tagged 10 ug
$600.00
RC202808L3 Lenti ORF clone of Human geminin, DNA replication inhibitor (GMNN), Myc-DDK-tagged 10 ug
$600.00
RC202808L4 Lenti ORF clone of Human geminin, DNA replication inhibitor (GMNN), mGFP tagged 10 ug
$600.00
RG202808 GMNN (tGFP-tagged) - Human geminin, DNA replication inhibitor (GMNN) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.