beta Actin (ACTB) (NM_001101) Human Untagged Clone

CAT#: SC319328

Reviews ()
Write a review

ACTB (untagged)-Human actin, beta (ACTB)



  "NM_001101" in other vectors (6)

Reconstitution Protocol

USD 457.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "ACTB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ACTB
Synonyms BRWS1; PS1TP5BP1
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001101.2 ACCGCGTCCGCCCCGCGAGCACAGAGCCTCGCCTTTGCCGATCCGCCGCCCGTCCACACC
CGCCGCCAGCTCACCATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGC
ATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTG
GGGCGCCCCAGGCACCAGGGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGC
GACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATC
GTCACCAACTGGGACGACATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGT
GTGGCTCCCGAGGAGCACCCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAAC
CGCGAGAAGATGACCCAGATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCT
ATCCAGGCTGTGCTATCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCC
GGTGACGGGGTCACCCACACTGTGCCCATCTACGAGGGGTATGCCCTCCCCCATGCCATC
CTGCGTCTGGACCTGGCTGGCCGGGACCTGACTGACTACCTCATGAAGATCCTCACCGAG
CGCGGCTACAGCTTCACCACCACGGCCGAGCGGGAAATCGTGCGTGACATTAAGGAGAAG
CTGTGCTACGTCGCCCTGGACTTCGAGCAAGAGATGGCCACGGCTGCTTCCAGCTCCTCC
CTGGAGAAGAGCTACGAGCTGCCTGACGGCCAGGTCATCACCATTGGCAATGAGCGGTTC
CGCTGCCCTGAGGCACTCTTCCAGCCTTCCTTCCTGGGCATGGAGTCCTGTGGCATCCAC
GAAACTACCTTCAACTCCATCATGAAGTGTGACGTGGACATCCGCAAAGACCTGTACGCC
AACACAGTGCTGTCTGGCGGCACCACCATGTACCCTGGCATTGCCGACAGGATGCAGAAG
GAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGC
AAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTCCAGCAGATG
TGGATCAGCAAGCAGGAGTATGACGAGTCCGGCCCCTCCATCGTCCACCGCAAATGCTTC
TAGGCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAACTTGCGCAGA
AAACAAGATGAGATTGGCATGGCTTTATTTGTTTTTTTTGTTTTGTTTTGGTTTTTTTTT
TTTTTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTT
GGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTT
TTTTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAA
AAGCCACCCCACTTCTCTCTAAGGAGAATGGCCCAGTCCTCTCCCAAGTCCACACAGGGG
AGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAATTTTTTTAATCTTCGCCTT
AATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCCTTCCCCCTT
TTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGC
AGCCAGGGCTTACCTGTACACTGACTTGAGACCAGTTGAATAAAAGTGCACACCTTAAAA
AAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_001101
Insert Size 1128 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001101.2, NP_001092.1
RefSeq Size 1793 bp
RefSeq ORF 1128 bp
Locus ID 60
UniProt ID P60709
Cytogenetics 7p22.1
Domains ACTIN
Protein Families ES Cell Differentiation/IPS
Protein Pathways Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Dilated cardiomyopathy, Focal adhesion, Hypertrophic cardiomyopathy (HCM), Leukocyte transendothelial migration, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton, Tight junction, Vibrio cholerae infection, Viral myocarditis
Gene Summary This gene encodes one of six different actin proteins. Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling. The encoded protein is a major constituent of the contractile apparatus and one of the two nonmuscle cytoskeletal actins that are ubiquitously expressed. Mutations in this gene cause Baraitser-Winter syndrome 1, which is characterized by intellectual disability with a distinctive facial appearance in human patients. Numerous pseudogenes of this gene have been identified throughout the human genome. [provided by RefSeq, Aug 2017]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.